FIGURE

Fig. S2

ID

ZDB-FIG-120118-26

Publication

Xu et al., 2012 - Gβγ signaling controls the polarization of zebrafish primordial germ cells by regulating Rac activity

Other Figures

All Figure Page

Back to All Figure Page

Fig. S2

Morpholinos (MOs) targeting gnb1 or gnb4 efficiently block translation of the corresponding ectopically expressed (GFP-tagged) proteins. (A-D) Epifluorescence images of groups of embryos injected with 100 pg gnb1a-gfp, gnb1b-gfp, gnb4a-gfp or gnb4b-gfp plasmid DNAs at the one-cell stage; GFP expression is strong at 60%-80% epiboly. (A′-D′) Co-injection of MO (4 ng) significantly suppressed the corresponding GFP expression. The following MOs (Gene-Tools) were used: gnb1a (GAGTTCGCTCATTTTCTTCTGCTTC), gnb1b (CTGGTCCAGTT CACTCATTTT CCTC), gnb4a (CCGCAACTGCTCCAGCTCACT CATG) and gnb4b (GACGCAACTGC TCCAACTCACTCAT). Scale bar: 1 mm.

Expression Data

Expression Detail

Antibody Labeling

Phenotype Data

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Development