CRISPR

CRISPR1-tamalin

ID
ZDB-CRISPR-240116-2
Name
CRISPR1-tamalin
Previous Names
None
Target
Sequence
5' - TCTCCACGGAGTTCTCACTTTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
km12 tamalin
Expression
Gene expression in Wild Types + CRISPR1-tamalin
No data available
Phenotype
Phenotype resulting from CRISPR1-tamalin
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tamalin
Phenotype Fish Conditions Figures
spinal cord axon structure, abnormal tamalinkm12/+ (AB) standard conditions Figure 4 with image from Seo et al., 2022
spinal cord neuron apoptotic, abnormal tamalinkm12/+ (AB) standard conditions Figure 2 with image from Seo et al., 2022
oligodendrocyte cell population proliferation increased process quality, abnormal tamalinkm12/+ (AB) standard conditions Figure 3 with image from Seo et al., 2022
oligodendrocyte apoptotic process increased process quality, abnormal tamalinkm12/+ (AB) standard conditions Figure 3 with image from Seo et al., 2022
spinal cord oligodendrocyte apoptotic, abnormal tamalinkm12/+ (AB) standard conditions Figure 3 with image from Seo et al., 2022
neuron apoptotic process increased process quality, abnormal tamalinkm12/+ (AB) standard conditions Figure 2 with image from Seo et al., 2022
spinal cord apoptotic process increased process quality, abnormal tamalinkm12/+ (AB) standard conditions Figure 2 with image from Seo et al., 2022
spinal cord myelination decreased process quality, abnormal tamalinkm12/+ (AB) standard conditions Figure 4 with image from Seo et al., 2022
spinal cord neuron grm5b expression increased amount, abnormal tamalinkm12/km12; km13Tg; nkuasgfp1aTg (AB) control Figure 7 with image from Seo et al., 2022
spinal cord neuron grm5a expression increased amount, abnormal tamalinkm12/km12; km13Tg; nkuasgfp1aTg (AB) control Figure 7 with image from Seo et al., 2022
spinal cord apoptotic process increased process quality, abnormal tamalinkm12/km12 + MO1-arf6a,arf6b (AB) control Figure 6 with imageFigure 7 with image from Seo et al., 2022
spinal cord apoptotic process process quality, ameliorated tamalinkm12/km12 + MO1-arf6a,arf6b (AB) chemical treatment by environment: 2-methyl-6-(phenylethynyl)pyridine Figure 7 with image from Seo et al., 2022
spinal cord neuron apoptotic, abnormal tamalinkm12/km12 + MO1-arf6a,arf6b (AB) control Figure 7 with image from Seo et al., 2022
neuron apoptotic process increased process quality, abnormal tamalinkm12/km12 + MO1-arf6a,arf6b (AB) control Figure 6 with image from Seo et al., 2022
oligodendrocyte apoptotic process increased process quality, abnormal tamalinkm12/km12 + MO1-arf6a,arf6b (AB) control Figure 6 with image from Seo et al., 2022
spinal cord oligodendrocyte decreased amount, abnormal tamalinkm12/km12; ck1Tg + MO1-arf6a,arf6b (AB) control Figure 6 with image from Seo et al., 2022
spinal cord neuron grm5b expression increased amount, abnormal tamalinkm12/km12; km13Tg; nkuasgfp1aTg + MO1-arf6a,arf6b (AB) control Figure 7 with image from Seo et al., 2022
spinal cord neuron grm5a expression increased amount, abnormal tamalinkm12/km12; km13Tg; nkuasgfp1aTg + MO1-arf6a,arf6b (AB) control Figure 7 with image from Seo et al., 2022
Citations