CRISPR

CRISPR1-ankk1

ID

ZDB-CRISPR-231102-1

Name

CRISPR1-ankk1

Previous Names

None

Target

ankk1 (1)

Sequence

5' - ATTGCTAAGGAGATTATCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
qm3	ankk1

Expression

Gene expression in Wild Types + CRISPR1-ankk1

No data available

Phenotype

Phenotype resulting from CRISPR1-ankk1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ankk1

Phenotype	Fish	Conditions	Figures
periventricular grey zone Ab1-ankk1 labeling absent, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 3 from Leggieri et al., 2022
startle response decreased process quality, abnormal	ankk1^qm3/qm3 (TU)	chemical treatment by environment: apomorphine	FIGURE 8 from Leggieri et al., 2022
whole organism drd5a expression decreased amount, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
habituation decreased process quality, abnormal	ankk1^qm3/qm3 (TU)	chemical treatment by environment: amisulpride	FIGURE 8 from Leggieri et al., 2022
hypothalamus dorsal region Ab1-drd2 labeling absent, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
brain drd2b expression increased amount, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
whole organism drd4b expression decreased amount, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
hindbrain Ab1-ankk1 labeling absent, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 3 from Leggieri et al., 2022
startle response decreased process quality, abnormal	ankk1^qm3/qm3 (TU)	chemical treatment by environment: amisulpride	FIGURE 8 from Leggieri et al., 2022
forebrain Ab1-ankk1 labeling decreased distribution, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 3 from Leggieri et al., 2022
ventral nucleus of ventral telencephalon Ab1-drd2 labeling decreased distribution, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
whole organism drd2b expression increased amount, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
periventricular grey zone Ab1-drd2 labeling absent, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
habituation decreased process quality, abnormal	ankk1^qm3/qm3 (TU)	chemical treatment by environment: apomorphine	FIGURE 8 from Leggieri et al., 2022
medial valvula cerebelli Ab1-drd2 labeling decreased distribution, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
lateral valvula cerebelli Ab1-drd2 labeling decreased distribution, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
parvocellular preoptic nucleus Ab1-drd2 labeling decreased distribution, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 4 from Leggieri et al., 2022
whole organism ankk1 expression decreased amount, abnormal	ankk1^qm3/qm3 (TU)	standard conditions	FIGURE 2 from Leggieri et al., 2022
startle response decreased process quality, abnormal	ankk1^qm3/+ (TU)	chemical treatment by environment: apomorphine	FIGURE 8 from Leggieri et al., 2022
whole organism drd1b expression increased amount, abnormal	ankk1^qm3/+ (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
whole organism drd2b expression decreased amount, abnormal	ankk1^qm3/+ (TU)	standard conditions	FIGURE 5 from Leggieri et al., 2022
habituation decreased process quality, abnormal	ankk1^qm3/+ (TU)	chemical treatment by environment: apomorphine	FIGURE 8 from Leggieri et al., 2022
startle response decreased process quality, abnormal	ankk1^qm3/+ (TU)	chemical treatment by environment: amisulpride	FIGURE 8 from Leggieri et al., 2022
whole organism ankk1 expression decreased amount, abnormal	ankk1^qm3/+ (TU)	standard conditions	FIGURE 2 from Leggieri et al., 2022

Citations