CRISPR

CRISPR1-nexmifa

ID

ZDB-CRISPR-230419-1

Name

CRISPR1-nexmifa

Previous Names

None

Target

nexmifa (1)

Sequence

5' - GGTGCCCGAAGAAGAGGCGGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3749	nexmifa

Expression

Gene expression in Wild Types + CRISPR1-nexmifa

No data available

Phenotype

Phenotype resulting from CRISPR1-nexmifa

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nexmifa

Phenotype	Fish	Conditions	Figures
neuron epha4b expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron plxna2 expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron sema4ba expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron ntn2 expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
CaP motoneuron axon decreased branchiness, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 3 from Zheng et al., 2022
neuron ephb1 expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron sema5ba expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
swimming behavior decreased process quality, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 4 , FIGURE 8 from Zheng et al., 2022
CaP motoneuron axon decreased length, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 3 from Zheng et al., 2022
primary motor neuron morphology, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 3 , FIGURE 7 from Zheng et al., 2022
neuron sema6ba expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 , FIGURE 7 from Zheng et al., 2022
neuron sema4c expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron srgap3 expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron nfatc2a expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron plxnb3 expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron efna5b expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 , FIGURE 7 from Zheng et al., 2022
neuron ephb2a expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron sema3e expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022
neuron pik3ca expression decreased amount, abnormal	nexmifa^{zf3749/zf3749}; ml2Tg	standard conditions	FIGURE 6 from Zheng et al., 2022

Citations