CRISPR

CRISPR1-thpo

ID

ZDB-CRISPR-230322-2

Name

CRISPR1-thpo

Previous Names

None

Target

thpo (1)

Sequence

5' - GGAGATTTCATGTTGTCGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
szy6	thpo

Expression

Gene expression in Wild Types + CRISPR1-thpo

No data available

Phenotype

Phenotype resulting from CRISPR1-thpo

No data available

Phenotype of all Fish created by or utilizing CRISPR1-thpo

Phenotype	Fish	Conditions	Figures
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	thpo^szy6/szy6 (AB)	standard conditions	Fig. 3 from Yang et al., 2022
whole organism Ab1-thpo labeling absent, abnormal	thpo^szy6/szy6 (AB)	standard conditions	Fig. 1 from Yang et al., 2022
blood thrombocyte decreased amount, abnormal	thpo^szy6/szy6; la2Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
head kidney thrombocyte decreased amount, abnormal	thpo^szy6/szy6; la2Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
head kidney hematopoietic multipotent progenitor cell increased amount, abnormal	thpo^szy6/szy6; la2Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
thrombocyte decreased amount, abnormal	thpo^szy6/szy6; la2Tg (AB)	standard conditions	Fig. 3 from Yang et al., 2022
thromboblast cell population proliferation decreased process quality, abnormal	thpo^szy6/szy6; la2Tg (AB)	standard conditions	Fig. 3 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte amount, ameliorated	thpo^szy6/szy6; sm9Tg (AB)	chemical treatment by environment: thrombopoietin receptor agonist	Fig. 5 from Yang et al., 2022
whole organism itga2b expression decreased amount, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
whole organism pou5f3 expression decreased amount, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte amount, ameliorated	thpo^szy6/szy6; sm9Tg (AB)	chemical treatment by environment: lusutrombopag	Fig. 5 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte decreased amount, abnormal	thpo^szy6/szy6; sm9Tg (AB)	control	Fig. 2, Fig. 4, Fig. 5 from Yang et al., 2022
whole organism nfe2 expression decreased amount, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte mpl expression decreased distribution, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte itga2b expression decreased distribution, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022
caudal hematopoietic tissue thrombocyte amount, ameliorated	thpo^szy6/szy6; sm9Tg (AB)	chemical treatment by environment: eltrombopag	Fig. 5 from Yang et al., 2022
whole organism mpl expression decreased amount, abnormal	thpo^szy6/szy6; sm9Tg (AB)	standard conditions	Fig. 2 from Yang et al., 2022

Citations