CRISPR

CRISPR1-stx4

ID
ZDB-CRISPR-221212-1
Name
CRISPR1-stx4
Previous Names
None
Target
Sequence
5' - GCTAGGAGTTGCACTTCCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ci1016 stx4
Expression
Gene expression in Wild Types + CRISPR1-stx4
No data available
Phenotype
Phenotype resulting from CRISPR1-stx4
No data available
Phenotype of all Fish created by or utilizing CRISPR1-stx4
Phenotype Fish Conditions Figures
otic vesicle malformed, abnormal stx4ci1016/ci1016 standard conditions Fig. 2 with image from Perl et al., 2022
heart contraction frequency, ameliorated stx4ci1016/ci1016 chemical treatment by environment: Bay-K-8644 Fig. 5 with imageFig. 6 with image from Perl et al., 2022
heart contraction decreased frequency, exacerbated stx4ci1016/ci1016 chemical treatment by environment: nifedipine Fig. 5 with image from Perl et al., 2022
cardiac muscle cell vesicle docking decreased process quality, abnormal stx4ci1016/ci1016 standard conditions Fig. 3 with image from Perl et al., 2022
heart looping decreased process quality, abnormal stx4ci1016/ci1016 standard conditions Fig. 2 with image from Perl et al., 2022
heart contraction decreased frequency, exacerbated stx4ci1016/ci1016 chemical treatment by environment: caffeine, chemical treatment by environment: thapsigargin Fig. 5 with image from Perl et al., 2022
cardiac muscle cell plasma membrane stx4 expression spatial pattern, abnormal stx4ci1016/ci1016 standard conditions Fig. 3 with image from Perl et al., 2022
heart contraction decreased frequency, abnormal stx4ci1016/ci1016 standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Perl et al., 2022
ventricular myocardium regulation of cardiac muscle contraction by calcium ion signaling decreased process quality, abnormal stx4ci1016/ci1016 standard conditions Fig. 4 with image from Perl et al., 2022
heart contraction decreased frequency, abnormal stx4ci1016/ci1016 chemical treatment by environment: NNC 55-0396 dihydrochloride Fig. 5 with image from Perl et al., 2022
cardiac muscle cell plasma membrane stx4 expression decreased amount, abnormal stx4ci1016/ci1016 standard conditions Fig. 3 with image from Perl et al., 2022
head edematous, abnormal stx4ci1016/ci1016 standard conditions Fig. 2 with image from Perl et al., 2022
atrial myocardium regulation of cardiac muscle contraction by calcium ion signaling decreased process quality, abnormal stx4ci1016/ci1016 standard conditions Fig. 4 with image from Perl et al., 2022
brain lacks all parts of type midbrain hindbrain boundary, abnormal stx4ci1016/ci1016 standard conditions Fig. 2 with image from Perl et al., 2022
heart contraction frequency, ameliorated stx4ci1016/ci1016; ci1018Tg/+ standard conditions Fig. 6 with image from Perl et al., 2022
heart contraction frequency, ameliorated stx4ci1016/ci1016; ci1019Tg/+ chemical treatment by environment: Bay-K-8644 Fig. 6 with image from Perl et al., 2022
heart contraction decreased frequency, abnormal stx4ci1016/ci1016; ci1019Tg/+ standard conditions Fig. 6 with image from Perl et al., 2022
Citations