CRISPR

CRISPR1-tulp1a

ID
ZDB-CRISPR-221207-2
Name
CRISPR1-tulp1a
Previous Names
None
Target
Sequence
5' - GTGCTCTCCTCATCACCCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu18 tulp1a
Expression
Gene expression in Wild Types + CRISPR1-tulp1a
No data available
Phenotype
Phenotype resulting from CRISPR1-tulp1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tulp1a
Phenotype Fish Conditions Figures
head tulp1a expression decreased amount, abnormal tulp1ahzu18/hzu18 standard conditions Fig. 1 with image from Jia et al., 2022
short single cone cell absence of anatomical entity, abnormal tulp1ahzu18/hzu18 standard conditions Fig. S3 from Jia et al., 2022
short single cone cell decreased length, abnormal tulp1ahzu18/hzu18 standard conditions Fig. S3 from Jia et al., 2022
eye ab2-gnat2 labeling absent, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
head tekt2 expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 4 with image from Jia et al., 2022
head tulp1a expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 1 with image from Jia et al., 2022
head fthl28 expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head ptgs2b expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
retinal rod cell ab5-rho labeling decreased distribution, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
eye ab1-gnat1 labeling absent, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
eye photoreceptor cell ferroptosis increased process quality, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
retinal photoreceptor layer atrophied, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
retina tulp1a expression decreased distribution, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 1 with image from Jia et al., 2022
eye Ab1-tulp1 labeling absent, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 1 with image from Jia et al., 2022
retina cilium decreased length, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 3 with image from Jia et al., 2022
eye photoreceptor cell intracellular iron ion homeostasis disrupted, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head tulp1b expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 1 with image from Jia et al., 2022
eye photoreceptor cell mitochondrial membrane decreased size, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head cyp2p10 expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head arl3l2 expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 4 with image from Jia et al., 2022
long single cone cell Ab2-opn1sw2 labeling decreased distribution, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
retina tulp1b expression decreased distribution, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 1 with image from Jia et al., 2022
head alox5b.3 expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head ab2-gnat2 labeling absent, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
head cep126 expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 4 with image from Jia et al., 2022
eye photoreceptor cell mitochondrial crista absence of anatomical entity, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head ab1-gnat1 labeling absent, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
retina photoreceptor disc membrane disorganized, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
head cp expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
retina accumulation retina lipid, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head gnat1 expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
eye ab2-gnat2 labeling decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. S3 from Jia et al., 2022
eye photoreceptor cell iron cation increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
head gnat2 expression decreased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 2 with image from Jia et al., 2022
head cyp2p9 expression increased amount, abnormal tulp1ahzu18/hzu18; tulp1bhzu19/hzu19 standard conditions Fig. 5 with image from Jia et al., 2022
Citations