CRISPR

CRISPR1-irx5b

ID
ZDB-CRISPR-221201-9
Name
CRISPR1-irx5b
Previous Names
None
Target
Sequence
5' - CCTGCGCGCGTTGGCGAACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el722 irx5b
Expression
Gene expression in Wild Types + CRISPR1-irx5b
No data available
Phenotype
Phenotype resulting from CRISPR1-irx5b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-irx5b
Phenotype Fish Conditions Figures
pectoral girdle decreased size, abnormal irx3bel837/el837; irx5bel722/el722 standard conditions Fig. 2 with image from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal irx3bel837/el837; irx5bel722/el722 standard conditions Fig. 6 with image from Farmer et al., 2021
Meckel's cartilage fused with Meckel's cartilage, abnormal irx3bel837/el837; irx5bel722/el722 standard conditions Fig. 6 with image from Farmer et al., 2021
scapulocoracoid decreased size, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 2 with image from Farmer et al., 2021
heart edematous, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 1 with image from Farmer et al., 2021
pharyngeal arch 6 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal arch 7 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 3 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 4 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 6 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal pouch 5 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
pharyngeal arch 5 absent, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836 standard conditions Fig. 5 with image from Farmer et al., 2021
Meckel's cartilage fused with ceratohyal bone, abnormal irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540 standard conditions Fig. 7 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratobranchial cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
palatoquadrate cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Meckel's cartilage absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
neurocranium absent, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
ceratohyal cartilage decreased size, abnormal irx1bel833/el833; irx3ael835/el835; irx3bel837/el837; irx5ael576/el576; irx5bel722/el722; irx6ael836/el836; irx7el540/el540; irx1ael830/+; irx2ael831/+; irx4ael832/+; irx4bel834/el834 standard conditions Fig. 3 with image from Farmer et al., 2021
Citations