CRISPR

CRISPR2-igf2bp3

ID
ZDB-CRISPR-221003-2
Name
CRISPR2-igf2bp3
Previous Names
None
Target
Sequence
5' - GGCTCCCTTCCTCGTAAAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added. The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ws001 igf2bp3
Expression
Gene expression in Wild Types + CRISPR2-igf2bp3
No data available
Phenotype
Phenotype resulting from CRISPR2-igf2bp3
No data available
Phenotype of all Fish created by or utilizing CRISPR2-igf2bp3
Phenotype Fish Conditions Figures
blastomere germ line cell ddx4 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
germ line cell ddx4 expression decreased distribution, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
yolk wnt8a expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
whole organism ddx4 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell ddx4 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell ddx4 expression decreased distribution, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell ddx4 expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
whole organism deformed, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
whole organism dead, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
yolk gdf3 expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
yolk wnt8a expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
blastomere germ line cell dnd1 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell ddx4 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
blastomere gdf3 expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
germ line cell ddx4 expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
yolk syncytial layer distended, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
whole organism igf2bp3 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 1 with image,  Fig 2 with image from Vong et al., 2021
yolk dazl expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
primordial germ cell ddx4 expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
yolk dazl expression spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
whole organism nanos1 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
primordial germ cell decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
blastomere germ line cell nanos1 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
whole organism dead, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
primordial germ cell spatial pattern, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
germ line cell ddx4 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
male organism ratio female organism, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 1 with image from Vong et al., 2021
blastoderm decreased size, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
blastomere gdf3 expression decreased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
primordial germ cell ddx4 expression decreased distribution, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 4 with image from Vong et al., 2021
whole organism mxtx2 expression increased amount, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
whole organism gastrulation decreased process quality, abnormal igf2bp3ws001/ws001 (TU) standard conditions Fig 2 with image from Vong et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.