CRISPR

CRISPR4-kif7

ID

ZDB-CRISPR-220310-1

Name

CRISPR4-kif7

Previous Names

None

Target

kif7 (1)

Sequence

5' - GGAAAGACAGCCCGTCACAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
co63	kif7
zf3491	kif7

Expression

Gene expression in Wild Types + CRISPR4-kif7

No data available

Phenotype

Phenotype resulting from CRISPR4-kif7

No data available

Phenotype of all Fish created by or utilizing CRISPR4-kif7

Phenotype	Fish	Conditions	Figures
whole organism smo expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
whole organism gli2a expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
whole organism ptch1 expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
whole organism kif7 expression decreased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
whole organism gli1 expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
whole organism krt4 expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
vertebral column rotational curvature, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 1 from Cuevas et al., 2023
vertebral column increased curvature, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 1 from Cuevas et al., 2023 Fig. 2 from Terhune et al., 2020
postcranial axial skeleton morphology, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 5 from Cuevas et al., 2023
whole organism smo expression decreased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Fig. 6 from Terhune et al., 2020
whole organism decreased life span, abnormal	kif7^co63/co63 (AB)	standard conditions	Fig. 3 from Terhune et al., 2020
whole organism dlg5a expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023 Fig. 6 from Terhune et al., 2020
vertebral column curved, abnormal	kif7^co63/co63 (AB)	standard conditions	Fig. 2 from Terhune et al., 2020
whole organism zgc:158846 expression increased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Figure 4A from Cuevas et al., 2023
fin kif7 expression decreased amount, abnormal	kif7^co63/co63 (AB)	standard conditions	Fig. 3 from Terhune et al., 2020
whole organism decreased life span, abnormal	kif7^co63/+ (AB)	standard conditions	Fig. 3 from Terhune et al., 2020
central canal cilium elongated, abnormal	kif7^co63/+ (AB)	standard conditions	Fig. 5 from Terhune et al., 2020
whole organism decreased life span, abnormal	kif7^zf3491/+; kif7^co63/+ (AB)	standard conditions	Fig. S1 from Terhune et al., 2020
trunk curved, abnormal	kif7^zf3491/+; kif7^co63/+ (AB)	standard conditions	Fig. S1 from Terhune et al., 2020

Citations