CRISPR

CRISPR1-eif2b3

ID
ZDB-CRISPR-211229-10
Name
CRISPR1-eif2b3
Previous Names
None
Target
Sequence
5' - GCGGTGCTGATGGCAGCCGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ck156a eif2b3
ck156b eif2b3
Expression
Gene expression in Wild Types + CRISPR1-eif2b3
No data available
Phenotype
Phenotype resulting from CRISPR1-eif2b3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-eif2b3
Phenotype Fish Conditions Figures
midbrain monocyte increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3 from Lee et al., 2021
forebrain olig2 expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3,  Fig. S2 from Lee et al., 2021
midbrain hindbrain boundary atf6 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S3 from Kim et al., 2021
liver xbp1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
midbrain hindbrain boundary psat1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S2 from Kim et al., 2021
heart edematous, abnormal eif2b3ck156a/ck156a standard conditions Fig. 1 from Lee et al., 2021
microglial cell decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3 from Lee et al., 2021
brain tp53 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
central nervous system glial cell (sensu Vertebrata) olig2 expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 1 with image from Kim et al., 2021
nervous system myelin sheath mbpa expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 1 with image from Kim et al., 2021
pancreas xbp1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
microglial cell apoeb expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3 from Lee et al., 2021
eye monocyte increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3 from Lee et al., 2021
midbrain hindbrain boundary abat expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
midbrain vegfaa expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 4 from Lee et al., 2021
whole organism dead, abnormal eif2b3ck156a/ck156a standard conditions Fig. 1 from Lee et al., 2021
midbrain neuronal stem cell nes expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 1 with image from Kim et al., 2021
retina olig2 expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3,  Fig. S2 from Lee et al., 2021
midbrain hindbrain boundary cad expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
midbrain hindbrain boundary septin6 expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
cranial ganglion mbpa expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 2 from Lee et al., 2021
lens decreased size, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Kim et al., 2021
intestine atf6 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
microglia differentiation disrupted, abnormal eif2b3ck156a/ck156a standard conditions Fig. 3 from Lee et al., 2021
midbrain hindbrain boundary slc1a4 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
midbrain hindbrain boundary atf4a expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S3 from Kim et al., 2021
posterior lateral line nerve mbpa expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. 2 from Lee et al., 2021
midbrain hindbrain boundary ass1 expression decreased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
liver atf6 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
whole organism decreased life span, abnormal eif2b3ck156a/ck156a standard conditions Fig. 1 from Lee et al., 2021
pancreas atf6 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
midbrain hindbrain boundary lonp1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Figure 4 with image from Kim et al., 2021
eye decreased size, abnormal eif2b3ck156a/ck156a standard conditions Fig. 1 from Lee et al., 2021
midbrain hindbrain boundary xbp1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S2 from Kim et al., 2021
intestine xbp1 expression increased amount, abnormal eif2b3ck156a/ck156a standard conditions Fig. S4 from Lee et al., 2021
oligodendrocyte myelination disrupted, abnormal eif2b3ck156a/ck156a; ck1Tg standard conditions Fig. 2 from Lee et al., 2021
myelination of posterior lateral line nerve axons disrupted, abnormal eif2b3ck156a/ck156a; ck1Tg standard conditions Fig. 2 from Lee et al., 2021
myelination disrupted, abnormal eif2b3ck156a/ck156a; ck5Tg standard conditions Figure 1 with image from Kim et al., 2021
midbrain cranial vasculature branchiness, ameliorated eif2b3ck156a/ck156a; s843Tg chemical treatment by environment: semaxanib Fig. 4 from Lee et al., 2021
midbrain cranial vasculature increased branchiness, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. 4 from Lee et al., 2021
intersegmental vessel angiogenesis increased occurrence, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. S3 from Lee et al., 2021
cranial vasculature increased branchiness, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. S3 from Lee et al., 2021
subintestinal vein angiogenesis increased occurrence, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. S3 from Lee et al., 2021
cranial vasculature angiogenesis increased occurrence, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. S3 from Lee et al., 2021
pharyngeal vasculature increased diameter, abnormal eif2b3ck156a/ck156a; s843Tg standard conditions Fig. 4 from Lee et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.