CRISPR

CRISPR2-ccm2

ID
ZDB-CRISPR-211004-3
Name
CRISPR2-ccm2
Previous Names
None
Target
Sequence
5' - GGAGAAGGGTAGGGATAAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-ccm2
No data available
Phenotype
Phenotype resulting from CRISPR2-ccm2
No data available
Phenotype of all Fish created by or utilizing CRISPR2-ccm2
Phenotype Fish Conditions Figures
spinal cord morphology, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
heart dilated, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 control Figure 5 with imageFigure 6 with image from Li et al., 2021
cerebellum brain vasculature morphology, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
brain anatomical surface lesioned, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
brain vasculature dilated, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
brainstem morphology, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
nucleate erythrocyte accumulation brain vasculature, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
brain vasculature morphology, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
caudal vein plexus dilated, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 4 with imageFigure 5 with imageFigure 6 with image from Li et al., 2021
forebrain brain vasculature morphology, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
brain hemorrhagic, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
caudal vein plexus structure, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment by environment: Y-27632 Figure 7 - figure supplement 2 with image from Li et al., 2021
caudal vein plexus structure, cavities, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 control Figure 7 - figure supplement 2 with image from Li et al., 2021
heart dilated, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-ccm2 standard conditions Figure 6 with image from Li et al., 2021
caudal vein plexus dilated, abnormal y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-ccm2 standard conditions Figure 6 with image from Li et al., 2021
developmental vascular plexus endothelial cell EGFP expression increased amount, abnormal ig11Tg; is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 4 with image from Li et al., 2021
developmental vascular plexus endothelial cell EGFP expression spatial pattern, abnormal ig11Tg; is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 4 with image from Li et al., 2021
caudal vein plexus dorsal side dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: (R)-(+)-propranolol Fig. 1 from Li et al., 2020
caudal vein plexus dorsal side dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 control Fig. 1Fig. 2 from Li et al., 2020
caudal vein plexus ventral side absent, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: (R)-(+)-propranolol Fig. 1 from Li et al., 2020
blood circulation decreased process quality, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with image from Li et al., 2021
caudal vein dorsal side diameter, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: propranolol Fig. 1 from Li et al., 2020
subintestinal vein increased branchiness, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 - figure supplement 2 with image from Li et al., 2021
intussusceptive angiogenesis arrested, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 2 with image from Li et al., 2021
caudal vein plexus folded, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: (R)-(+)-propranolol Fig. 1 from Li et al., 2020
caudal vein plexus folded, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 control Fig. 1Fig. 2 from Li et al., 2020
caudal vein plexus ventral side absent, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 control Fig. 1Fig. 2 from Li et al., 2020
heart dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with imageFigure 1 - figure supplement 2 with image from Li et al., 2021
Fig. 1 from Li et al., 2020
nucleate erythrocyte accumulation caudal vein plexus, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with imageFigure 2 with image from Li et al., 2021
caudal vein plexus dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with imageFigure 2 with image from Li et al., 2021
caudal vein plexus ventral side present, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: propranolol Fig. 1 from Li et al., 2020
caudal vein dorsal side diameter, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: metoprolol Fig. 2 from Li et al., 2020
caudal vein plexus structure, cavities, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with imageFigure 2 with image from Li et al., 2021
caudal vein plexus anatomical surface irregularly shaped, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 2 with image from Li et al., 2021
heart dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: (R)-(+)-propranolol Fig. 1 from Li et al., 2020
caudal vein plexus morphology, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: propranolol Fig. 1 from Li et al., 2020
cranial blood vessel dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 1 with image from Li et al., 2021
caudal vein plexus lumen obstructed, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 2 with image from Li et al., 2021
heart dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 chemical treatment: propranolol Fig. 1 from Li et al., 2020
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-gata1a standard conditions Figure 4 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a standard conditions Figure 4 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO3-trim33 standard conditions Figure 4 with image from Li et al., 2021
caudal vein plexus size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
heart size, ameliorated y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-klf2a + MO2-klf2b control Figure 5 with image from Li et al., 2021
caudal vein plexus endothelial cell EGFP expression increased amount, abnormal ig11Tg; is5Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-tnnt2a standard conditions Figure 4 with image from Li et al., 2021
brain vasculature morphology, ameliorated klf2aig4/ig4; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 standard conditions Figure 7 with image from Li et al., 2021
caudal vein plexus dorsal side dilated, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-adrb2a control Fig. 2 from Li et al., 2020
caudal vein plexus folded, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-adrb2a control Fig. 2 from Li et al., 2020
caudal vein plexus ventral side absent, abnormal sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO1-adrb2a control Fig. 2 from Li et al., 2020
caudal vein plexus ventral side present, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO2-adrb1 control Fig. 2 from Li et al., 2020
caudal vein plexus morphology, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO2-adrb1 control Fig. 2 from Li et al., 2020
caudal vein dorsal side diameter, ameliorated sd2Tg; y1Tg + CRISPR1-ccm2 + CRISPR2-ccm2 + CRISPR3-ccm2 + CRISPR4-ccm2 + MO2-adrb1 control Fig. 2 from Li et al., 2020
Citations