CRISPR

CRISPR8-mab21l2

ID

ZDB-CRISPR-210922-1

Name

CRISPR8-mab21l2

Previous Names

None

Target

mab21l2 (1)

Sequence

5' - GGTGTCGGATGTGCTGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
u517	mab21l2

Expression

Gene expression in Wild Types + CRISPR8-mab21l2

No data available

Phenotype

Phenotype resulting from CRISPR8-mab21l2

No data available

Phenotype of all Fish created by or utilizing CRISPR8-mab21l2

Phenotype	Fish	Conditions	Figures
lens decreased size, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
ciliary marginal zone increased size, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
retina ccnd1 expression decreased amount, abnormal	mab21l2^u517/u517	control	Fig. 4 from Wycliffe et al., 2020
retina atoh7 expression spatial pattern, abnormal	mab21l2^u517/u517	control	Fig. 5 from Wycliffe et al., 2020
eye ccnd1 expression increased distribution, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
retina neurogenesis delayed, abnormal	mab21l2^u517/u517	control	Fig. 5 from Wycliffe et al., 2020
eye ccnd1 expression mislocalised, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
ciliary marginal zone has extra parts of type cell, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
optic cup ccnd1 expression decreased amount, abnormal	mab21l2^u517/u517	control	Fig. 4 from Wycliffe et al., 2020
retina ccnd1 expression mislocalised, abnormal	mab21l2^u517/u517	control	Fig. 4 from Wycliffe et al., 2020
eye cell population proliferation decreased occurrence, abnormal	mab21l2^u517/u517	standard conditions	Fig. 4 from Wycliffe et al., 2020
retina atoh7 expression decreased distribution, abnormal	mab21l2^u517/u517	control	Fig. 5 from Wycliffe et al., 2020
eye decreased size, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
eye dorso-ventrally flattened, abnormal	mab21l2^u517/u517	control	Fig. 1 from Wycliffe et al., 2020
retina layer formation process quality, abnormal	mab21l2^u517/u517; cu2Tg	standard conditions	Fig. 5 from Wycliffe et al., 2020
optic vesicle EGFP expression decreased amount, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 2 from Wycliffe et al., 2020
eye decreased volume, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
eye decreased size, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
eye dorso-ventrally flattened, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
optic cup EGFP expression decreased amount, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
eye EGFP expression decreased amount, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
lens decreased size, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
retina dorsal region morphology, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020
eye development process quality, abnormal	mab21l2^u517/u517; nns1Tg	standard conditions	Fig. 3 from Wycliffe et al., 2020

Citations