CRISPR

CRISPR1-aldh3a1

ID
ZDB-CRISPR-210817-5
Name
CRISPR1-aldh3a1
Previous Names
None
Target
Sequence
5' - GGGGTCTGGATCTGCCTGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3260 aldh3a1
Expression
Gene expression in Wild Types + CRISPR1-aldh3a1
No data available
Phenotype
Phenotype resulting from CRISPR1-aldh3a1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-aldh3a1
Phenotype Fish Conditions Figures
whole organism ins expression decreased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 5 with image from Lou et al., 2020
whole organism asparagine decreased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 7 with imageFig. 8 with image from Lou et al., 2020
whole organism glucose increased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism 4-hydroxynon-2-enal increased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 8 with image from Lou et al., 2020
whole organism cysteine decreased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 8 with image from Lou et al., 2020
glucose homeostasis disrupted, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism pdx1 expression decreased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 5 with image from Lou et al., 2020
whole organism methionine decreased amount, abnormal aldh3a1zf3260/zf3260 standard conditions Fig. 7 with imageFig. 8 with image from Lou et al., 2020
ocular blood vessel increased diameter, abnormal aldh3a1zf3260/zf3260; y1Tg control Fig. 4 with image from Lou et al., 2020
intersegmental vessel morphology, abnormal aldh3a1zf3260/zf3260; y1Tg control Fig. 3 with image from Lou et al., 2020
whole organism ATP decreased amount, abnormal aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism ADP decreased amount, abnormal aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
whole organism glucose increased amount, exacerbated aldh3a1zf3260/zf3260 + MO1-pdx1 standard conditions Fig. 7 with image from Lou et al., 2020
intersegmental vessel morphology, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
ocular blood vessel increased diameter, abnormal aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 4 with image from Lou et al., 2020
intersegmental vessel increased branchiness, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 3 with image from Lou et al., 2020
ocular blood vessel sprouting angiogenesis increased process quality, exacerbated aldh3a1zf3260/zf3260; y1Tg + MO1-pdx1 standard conditions Fig. 4 with image from Lou et al., 2020
Citations