CRISPR

CRISPR4-tie1

ID

ZDB-CRISPR-210726-5

Name

CRISPR4-tie1

Previous Names

None

Target

tie1 (1)

Sequence

5' - TCAGCAAGTGGGACGGCCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bns208	tie1

Expression

Gene expression in Wild Types + CRISPR4-tie1

No data available

Phenotype

Phenotype resulting from CRISPR4-tie1

No data available

Phenotype of all Fish created by or utilizing CRISPR4-tie1

Phenotype	Fish	Conditions	Figures
heart looping decreased process quality, abnormal	tie1^{bns208/bns208}; f2Tg; y7Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
heart has fewer parts of type cardiac muscle cell, abnormal	tie1^{bns208/bns208}; f2Tg; y7Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
heart has fewer parts of type endocardium, abnormal	tie1^{bns208/bns208}; f2Tg; y7Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
endocardium endothelial cell shortened, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 5 from Carlantoni et al., 2020
myocardium cell population proliferation decreased occurrence, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
heart malformed, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 1 from Carlantoni et al., 2020
endocardium endothelial cell decreased distance endocardium endothelial cell, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 5 from Carlantoni et al., 2020
caudal vein plexus decreased size, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 1 from Carlantoni et al., 2020
brain angiogenesis decreased occurrence, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 1 from Carlantoni et al., 2020
cardiac jelly increased thickness, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
heart edematous, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 1 from Carlantoni et al., 2020
common cardinal vein decreased diameter, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 1 from Carlantoni et al., 2020
endocardium cell population proliferation decreased occurrence, abnormal	tie1^{bns208/bns208}; s843Tg	standard conditions	Fig. 3 from Carlantoni et al., 2020
cardiac muscle cell circular, abnormal	tie1^{bns208/bns208}; s883Tg	standard conditions	Fig. 4 from Carlantoni et al., 2020
posterior cardinal vein has fewer parts of type posterior cardinal vein blood vessel endothelial cell, abnormal	tie1^{bns208/bns208}; y7Tg	standard conditions	Fig. 2 from Carlantoni et al., 2020
common cardinal vein has fewer parts of type common cardinal vein blood vessel endothelial cell, abnormal	tie1^{bns208/bns208}; y7Tg	standard conditions	Fig. 2 from Carlantoni et al., 2020
dorsal aorta has fewer parts of type dorsal aorta blood vessel endothelial cell, abnormal	tie1^{bns208/bns208}; y7Tg	standard conditions	Fig. 2 from Carlantoni et al., 2020
intersegmental vessel has fewer parts of type intersegmental vessel blood vessel endothelial cell, abnormal	tie1^{bns208/bns208}; y7Tg	standard conditions	Fig. 2 from Carlantoni et al., 2020
cardiac muscle cell sarcomere decreased thickness, abnormal	tie1^{bns208/bns208}; sd10Tg	standard conditions	Fig. 4 from Carlantoni et al., 2020

Citations