CRISPR

CRISPR12-kmt2d

ID
ZDB-CRISPR-200515-2
Name
CRISPR12-kmt2d
Previous Names
None
Target
Sequence
5' - GTATTGACTGTGGCATGCGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zy58 kmt2d
zy59 kmt2d
zy60 kmt2d
Expression
Gene expression in Wild Types + CRISPR12-kmt2d
Phenotype
Phenotype resulting from CRISPR12-kmt2d
Phenotype of all Fish created by or utilizing CRISPR12-kmt2d
Phenotype Fish Conditions Figures
head decreased size, abnormal kmt2dzy58/zy58 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
pericardium edematous, abnormal kmt2dzy58/zy58 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
whole organism anterior-posterior axis decreased length, abnormal kmt2dzy58/zy58 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
ethmoid cartilage morphology, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
head decreased size, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 1 with imageFig 2 with image from Serrano et al., 2019
cranial cartilage lacks parts or has fewer parts of type palatoquadrate cartilage, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
pharyngeal arch cartilage lacks parts or has fewer parts of type hyosymplectic cartilage, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
Meckel's cartilage absent, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
ethmoid cartilage decreased length, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
basihyal cartilage absent, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
pharyngeal arch cartilage lacks parts or has fewer parts of type ceratohyal cartilage, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
whole organism rbpja expression increased amount, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 6 with image from Serrano et al., 2019
ventral hyoid arch malformed, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
whole organism anterior-posterior axis decreased length, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
pericardium edematous, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
ventral hyoid arch lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal kmt2dzy59/zy59 (AB) standard conditions Fig 2 with image from Serrano et al., 2019
head decreased size, abnormal kmt2dzy60/zy60 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
pericardium edematous, abnormal kmt2dzy60/zy60 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
whole organism anterior-posterior axis decreased length, abnormal kmt2dzy60/zy60 (AB) standard conditions Fig 1 with image from Serrano et al., 2019
atrium notch1b expression spatial pattern, abnormal um14Tg + CRISPR12-kmt2d standard conditions Fig 6 with image from Serrano et al., 2019
cardiac ventricle notch1b expression increased distribution, abnormal um14Tg + CRISPR12-kmt2d standard conditions Fig 6 with image from Serrano et al., 2019
heart rbpja expression increased amount, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 6 with image from Serrano et al., 2019
lateral dorsal aorta ventral region lacks parts or has fewer parts of type aortic arch, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
heart nucleus rbpja expression increased amount, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 6 with image from Serrano et al., 2019
cranial blood vessel lumen decreased diameter, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
aortic arch cell population proliferation decreased occurrence, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 7 with image from Serrano et al., 2019
inner optic circle increased diameter, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
ventricular endocardium cell division decreased occurrence, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
aortic arch cell population proliferation decreased occurrence, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
dorsal ciliary vein increased diameter, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
aortic arch 1 immature, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
pericardium edematous, abnormal kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
vascular endothelium endothelial cell proliferation decreased occurrence, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
cardiac ventricle lumen obstructed, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
head muscle ab-mf20 labeling spatial pattern, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 7 with image from Serrano et al., 2019
heart morphology, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
ventral aorta misrouted, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
ventricular endocardium hypoplastic, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
cardiac ventricle hypoplastic, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
endocardium cell population proliferation occurrence, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
opercular artery has extra parts of type angiogenic sprout, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
heart contraction decreased rate, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
anterior cerebral vein misrouted, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
aortic arch morphology, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with imageFig 9 with image from Serrano et al., 2019
endocardium cell population proliferation decreased occurrence, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 7 with image from Serrano et al., 2019
oral region vasculature decreased size, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
sternohyoid deformed, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 7 with image from Serrano et al., 2019
sternohyoid deformed, abnormal kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
aortic arch angiogenesis delayed, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
endocardium rbpja expression spatial pattern, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 8 with image from Serrano et al., 2019
ventricular endocardium morphology, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
hypobranchial artery incomplete structure, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
cardiac ventricle volume, ameliorated kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
pharyngeal arch 3-7 lacks parts or has fewer parts of type aortic arch, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
aortic arch morphology, abnormal kmt2dzy59/zy59; la116Tg control Fig 7 with imageFig 9 with image from Serrano et al., 2019
central artery misrouted, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
heart morphology, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 6 with image from Serrano et al., 2019
nasal ciliary artery increased diameter, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with image from Serrano et al., 2019
pericardium edematous, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 7 with image from Serrano et al., 2019
head muscle ab-mf20 labeling spatial pattern, abnormal kmt2dzy59/zy59; la116Tg chemical treatment by environment: DAPT Fig 7 with image from Serrano et al., 2019
aortic arch 1 has extra parts of type angiogenic sprout, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
endocardium rbpja expression increased distribution, abnormal kmt2dzy59/zy59; la116Tg control Fig 8 with image from Serrano et al., 2019
ventricular endocardium separated from ventricular myocardium, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 3 with image from Serrano et al., 2019
opercular artery decreased size, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
cranial vasculature malformed, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 4 with imageFig 7 with image from Serrano et al., 2019
aortic arch lumen decreased diameter, abnormal kmt2dzy59/zy59; la116Tg standard conditions Fig 5 with image from Serrano et al., 2019
Citations