CRISPR

CRISPR4-csf1rb

ID

ZDB-CRISPR-200427-4

Name

CRISPR4-csf1rb

Previous Names

None

Target

csf1rb (1)

Sequence

5' - GATACTGCGGATCCCAGACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The G at the beginning was added to improve binding.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mh108	csf1rb
mh112	csf1rb

Expression

Gene expression in Wild Types + CRISPR4-csf1rb

No data available

Phenotype

Phenotype resulting from CRISPR4-csf1rb

No data available

Phenotype of all Fish created by or utilizing CRISPR4-csf1rb

Phenotype	Fish	Conditions	Figures
scale bone resorption decreased occurrence, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
scale csf1rb expression absent, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
centrum decreased volume, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
ceratobranchial 5 tooth basal surface osseous, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 4 from Caetano-Lopes et al., 2020
centrum bone mineralization increased process quality, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
centrum increased mass density, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
neural arch dorsal orientation, abnormal	csf1rb^mh108/mh108 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
neural arch decreased area, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
scale csf1rb expression absent, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
centrum decreased volume, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
scale bone resorption decreased occurrence, exacerbated	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
integument has fewer parts of type melanocyte, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
scale csf1ra expression absent, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
ceratobranchial 5 bone has extra parts of type ceratobranchial 5 tooth, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 4 from Caetano-Lopes et al., 2020
centrum increased mass density, exacerbated	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
integument lacks all parts of type xanthophore, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
centrum increased diameter, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
pigment cell development decreased process quality, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 2 from Caetano-Lopes et al., 2020
ceratobranchial 5 bone odontogenesis increased occurrence, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 4 from Caetano-Lopes et al., 2020
neural arch dorsal orientation, abnormal	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020
centrum bone mineralization increased process quality, exacerbated	csf1rb^mh112/mh112; csf1ra^mh5/mh5 (AB)	standard conditions	Fig. 3 from Caetano-Lopes et al., 2020

Citations