CRISPR

CRISPR1-trpv6

ID
ZDB-CRISPR-200324-4
Name
CRISPR1-trpv6
Previous Names
None
Target
Sequence
5' - GGGCTCGTTGATGAGCTCCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mi604 trpv6
mi605 trpv6
mi606 trpv6
Expression
Gene expression in Wild Types + CRISPR1-trpv6
No data available
Phenotype
Phenotype resulting from CRISPR1-trpv6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-trpv6
Phenotype Fish Conditions Figures
whole organism ab9-mapk labeling decreased amount, abnormal trpv6mi604/+; mi602Tg chemical treatment: U0126 Figure 3 with image from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi604/+; mi602Tg chemical treatment: gadolinium trichloride Figure 2 with image from Xin et al., 2019
integument ab2-rps6 labeling amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte ab2-rps6 labeling amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
integument ab5-akt labeling amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte ab2-rps6 labeling increased amount, abnormal trpv6mi604/mi604; mi602Tg control Figure 3 with image from Xin et al., 2019
whole organism decreased life span, abnormal trpv6mi604/mi604; mi602Tg control Figure 1 with image from Xin et al., 2019
bone element calcium phosphate decreased amount, abnormal trpv6mi604/mi604; mi602Tg control Figure 1 with image from Xin et al., 2019
NaK ionocyte ab5-akt labeling increased amount, abnormal trpv6mi604/mi604; mi602Tg control Figure 3 with image from Xin et al., 2019
whole organism morphology, abnormal trpv6mi604/mi604; mi602Tg control Figure 1 supplement 1 with image from Xin et al., 2019
whole organism ab9-mapk labeling increased amount, abnormal trpv6mi604/mi604; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi604/mi604; mi602Tg control Figure 2 with imageFigure 3 with image from Xin et al., 2019
NaK ionocyte amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi604/mi604; mi602Tg chemical treatment: gadolinium trichloride Figure 2 with image from Xin et al., 2019
integument ab5-akt labeling increased distribution, abnormal trpv6mi604/mi604; mi602Tg control Figure 3 with image from Xin et al., 2019
whole organism ab9-mapk labeling amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: U0126 Figure 3 with image from Xin et al., 2019
integument ab2-rps6 labeling increased distribution, abnormal trpv6mi604/mi604; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte ab5-akt labeling amount, ameliorated trpv6mi604/mi604; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
whole organism trpv6 expression increased amount, abnormal trpv6mi605/+; mi602Tg low calcium Fig. 3 supplemental 1 from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi605/+; mi602Tg low calcium Figure 3 with image from Xin et al., 2019
NaK ionocyte ab2-rps6 labeling amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
integument ab2-rps6 labeling amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: wortmannin Figure 3 with image from Xin et al., 2019
integument ab5-akt labeling amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte ab2-rps6 labeling increased amount, abnormal trpv6mi605/mi605; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: U0126 Figure 3 with image from Xin et al., 2019
whole organism decreased life span, abnormal trpv6mi605/mi605; mi602Tg control Figure 1 with image from Xin et al., 2019
NaK ionocyte ab5-akt labeling increased amount, abnormal trpv6mi605/mi605; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: sirolimus Figure 3 with image from Xin et al., 2019
NaK ionocyte amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
integument ab5-akt labeling increased distribution, abnormal trpv6mi605/mi605; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi605/mi605; mi602Tg control Figure 2 with imageFigure 3 with image from Xin et al., 2019
integument ab2-rps6 labeling increased distribution, abnormal trpv6mi605/mi605; mi602Tg control Figure 3 with image from Xin et al., 2019
NaK ionocyte ab5-akt labeling amount, ameliorated trpv6mi605/mi605; mi602Tg chemical treatment: BMS-754807 Figure 3 with image from Xin et al., 2019
NaK ionocyte increased amount, abnormal trpv6mi605/mi605; mi602Tg low calcium Figure 3 with image from Xin et al., 2019
NaK ionocyte GCaMP expression decreased amount, abnormal trpv6mi606/mi606; mi603Tg/+ control Figure 4 with image from Xin et al., 2019
NaK ionocyte GCaMP expression amount, ameliorated trpv6mi606/mi606; mi603Tg/+ chemical treatment: ionomycin Figure 4 with image from Xin et al., 2019
Citations