CRISPR

CRISPR4-socs3b

ID
ZDB-CRISPR-181119-7
Name
CRISPR4-socs3b
Previous Names
  • Z001423 (1)
Target
Sequence
5' - GGCGCACGCCGCCTTCAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mdu24 socs3b
Expression
Gene expression in Wild Types + CRISPR4-socs3b
No data available
Phenotype
Phenotype resulting from CRISPR4-socs3b
No data available
Phenotype of all Fish created by or utilizing CRISPR4-socs3b
Phenotype Fish Conditions Figures
whole organism tgfb1b expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
eye il1b expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
whole organism il6 expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
eye tnfa expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
eye il4 expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
neutrophil mpx expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 2 with image,  Figure 3 with image from Sobah et al., 2023
whole organism cxcl8a expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
whole organism cxcr3.2 expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
leukocyte lcp1 expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 3 with image from Sobah et al., 2023
whole organism ccr2 expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
whole organism decreased length, abnormal socs3bmdu24/mdu24 standard conditions Figure 6 with image from Sobah et al., 2023
eye cxcr3.2 expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
leukocyte csf3r expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 3 with image from Sobah et al., 2023
whole organism il1b expression increased amount, abnormal socs3bmdu24/mdu24 ablation: caudal fin Figure 5 with image from Sobah et al., 2023
eye il6 expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
eye il21 expression increased amount, abnormal socs3bmdu24/mdu24 standard conditions Figure 7 with image from Sobah et al., 2023
eye macrophage increased amount, abnormal socs3bmdu24/mdu24; gl22Tg/gl22Tg standard conditions Figure 7 with image from Sobah et al., 2023
kidney macrophage decreased amount, abnormal socs3bmdu24/mdu24; gl22Tg/gl22Tg standard conditions Figure 6 with image from Sobah et al., 2023
macrophage wound healing involved in inflammatory response increased process quality, abnormal socs3bmdu24/mdu24; gl22Tg/gl22Tg ablation: caudal fin Figure 5 with image from Sobah et al., 2023
whole organism mpx expression increased amount, abnormal socs3bmdu24/mdu24; gl22Tg/gl22Tg standard conditions Figure 6 with image from Sobah et al., 2023
whole organism semi-viable, abnormal socs3bmdu24/mdu24; gl22Tg/gl22Tg standard conditions Figure 7 with image from Sobah et al., 2023
neutrophil increased amount, exacerbated socs3bmdu24/mdu24; i114Tg/i114Tg chemical treatment by environment: lipopolysaccharide Figure 4 with image from Sobah et al., 2023
neutrophil EGFP expression increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 3 with image,  Figure 4 with image from Sobah et al., 2023
kidney neutrophil increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 6 with image from Sobah et al., 2023
eye neutrophil increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 7 with image from Sobah et al., 2023
neutrophil wound healing involved in inflammatory response decreased process quality, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg ablation: caudal fin Figure 5 with image from Sobah et al., 2023
whole organism mpx expression increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 6 with image from Sobah et al., 2023
neutrophil increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 4 with image from Sobah et al., 2023
neutrophil EGFP expression increased amount, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg chemical treatment by environment: lipopolysaccharide Figure 4 with image from Sobah et al., 2023
whole organism semi-viable, abnormal socs3bmdu24/mdu24; i114Tg/i114Tg standard conditions Figure 7 with image from Sobah et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.