CRISPR

CRISPR1-traf4a

ID

ZDB-CRISPR-181115-1

Name

CRISPR1-traf4a

Previous Names

None

Target

traf4a (1)

Sequence

5' - AGCGTCTCTTGGGCTTCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ca301	traf4a

Expression

Gene expression in Wild Types + CRISPR1-traf4a

No data available

Phenotype

Phenotype resulting from CRISPR1-traf4a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-traf4a

Phenotype	Fish	Conditions	Figures
optic vesicle decreased size, abnormal	traf4a^ca301/ca301	standard conditions	Fig. 5 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	traf4a^ca301/ca301	standard conditions	Fig. 5 from Hehr et al., 2018
head bilateral symmetry, abnormal	traf4a^ca301/ca301	standard conditions	Fig. 5 from Hehr et al., 2018
head bilateral symmetry, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle decreased size, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
eye apoptotic process increased occurrence, abnormal	traf4a^ca301/ca301 + MO1-traf4a	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle decreased size, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle epithelium disorganized, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle increased variability of size, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle apical surface ab1-prkcz labeling spatial pattern, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018
epithelium adherens junction organization disrupted, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 , Fig. 7 from Hehr et al., 2018
optic vesicle ab1-prkcz labeling mislocalised, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018
optic cup morphogenesis involved in camera-type eye development disrupted, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 8 from Hehr et al., 2018
optic vesicle asymmetrical, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle neuroepithelial cell displaced to posterior segment eye anatomical space, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 6 from Hehr et al., 2018
optic vesicle establishment of apical/basal cell polarity disrupted, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle elongation disrupted, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 8 from Hehr et al., 2018
optic vesicle ab1-lama1 labeling mislocalised, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle apical surface ab1-tjp1 labeling spatial pattern, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018
optic vesicle basal surface ab1-lama1 labeling spatial pattern, abnormal	traf4a^ca301/ca301; zf460Tg	standard conditions	Fig. 7 from Hehr et al., 2018

Citations