CRISPR

CRISPR4-eys

ID

ZDB-CRISPR-181029-1

Name

CRISPR4-eys

Previous Names

None

Target

eys (1)

Sequence

5' - GGTGCAGGAAAACTCCCCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
rmc101	eys

Expression

Gene expression in Wild Types + CRISPR4-eys

No data available

Phenotype

Phenotype resulting from CRISPR4-eys

No data available

Phenotype of all Fish created by or utilizing CRISPR4-eys

Phenotype	Fish	Conditions	Figures
eye photoreceptor cell photoreceptor outer segment disorganized, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
eye photoreceptor cell photoreceptor outer segment shortened, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
retina detection of light stimulus involved in visual perception decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 3 from Messchaert et al., 2018
retinal outer plexiform layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
retinal outer nuclear layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. S3 from Messchaert et al., 2018
visual behavior decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	lighting conditions	Figure 7 from Schellens et al., 2021
eye photoreceptor cell photoreceptor connecting cilium eys expression absent, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 5 from Schellens et al., 2021
eye photoreceptor cell eys expression absent, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
photoreceptor inner segment layer rho expression mislocalised, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
retinal inner nuclear layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
eye photoreceptor cell synapse rho expression mislocalised, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
photoreceptor outer segment layer disorganized, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
visual perception decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	lighting conditions	Figure 7 from Schellens et al., 2021
eye photoreceptor cell synapse ab2-gnat2 labeling mislocalised, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
retinal outer nuclear layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
photoreceptor cell outer segment organization decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
retinal ganglion cell layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021
retinal inner nuclear layer decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. S3 from Messchaert et al., 2018
photoreceptor inner segment layer ab2-gnat2 labeling mislocalised, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
visual behavior decreased process quality, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 4 from Messchaert et al., 2018
eye photoreceptor cell photoreceptor outer segment malformed, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Fig. 2 from Messchaert et al., 2018
retinal pigmented epithelium decreased thickness, abnormal	eys^{rmc101/rmc101} (TL)	standard conditions	Figure 6 from Schellens et al., 2021

Citations