CRISPR

CRISPR1-mipa

ID
ZDB-CRISPR-181017-4
Name
CRISPR1-mipa
Previous Names
None
Target
Sequence
5' - GGCACGAAACAGGGACATCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ir1090 mipa
Expression
Gene expression in Wild Types + CRISPR1-mipa
No data available
Phenotype
Phenotype resulting from CRISPR1-mipa
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mipa
Phenotype Fish Conditions Figures
lens central region refractivity, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens malformed, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 6 with image from Vorontsova et al., 2018
lens anterior region opaque, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 3 with image from Vorontsova et al., 2018
lens opacity, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 7 with image from Wang et al., 2021
lens fiber cell lens fiber cell morphogenesis decreased process quality, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 7 with image from Vorontsova et al., 2018
lens lens morphogenesis in camera-type eye decreased process quality, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 6 with image from Vorontsova et al., 2018
lens increased diameter, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 1 with image from Wang et al., 2021
lens fiber cell mipa expression absent, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 1 with imageFig. 5 with image from Vorontsova et al., 2018
lens refractivity, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 2 with image from Wang et al., 2021
Fig. 4 with image from Vorontsova et al., 2018
lens lens development in camera-type eye decreased process quality, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Vorontsova et al., 2018
lens central region opaque, abnormal mipair1090/ir1090 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens decreased diameter, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 1 with image from Wang et al., 2021
lens central region refractivity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 2 with image from Vorontsova et al., 2018
lens anterior region opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 3 with image from Vorontsova et al., 2018
lens fiber cell lens fiber cell morphogenesis decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 7 with image from Vorontsova et al., 2018
lens lens morphogenesis in camera-type eye decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 6 with image from Vorontsova et al., 2018
lens opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 3 with image from Vorontsova et al., 2018
lens opacity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 9 with imageFig. 10 with image from Wang et al., 2021
lens refractivity, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 4 with imageFig. 5 with image from Wang et al., 2021
Fig. 4 with image from Vorontsova et al., 2018
lens lens development in camera-type eye decreased process quality, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Vorontsova et al., 2018
lens central region opaque, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 2 with imageFig. 4 with image from Vorontsova et al., 2018
lens malformed, abnormal mipair1090/ir1090; mipbir1091/ir1091 (AB) standard conditions Fig. 6 with image from Vorontsova et al., 2018
Citations