CRISPR

CRISPR1-smarca5

ID
ZDB-CRISPR-180213-390
Name
CRISPR1-smarca5
Previous Names
None
Target
Sequence
5' - GGACCTGCTGGGTGGATATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zko1049a smarca5
zko1049b smarca5
Expression
Gene expression in Wild Types + CRISPR1-smarca5
No data available
Phenotype
Phenotype resulting from CRISPR1-smarca5
No data available
Phenotype of all Fish created by or utilizing CRISPR1-smarca5
Phenotype Fish Conditions Figures
caudal vein plexus blood coagulation, fibrin clot formation increased frequency, ameliorated smarca5zko1049a/zko1049a chemical treatment by environment: argatroban Figure 2 with image from Ding et al., 2021
nucleate erythrocyte fbp1a expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
thymus rag1 expression decreased distribution, abnormal smarca5zko1049a/zko1049a standard conditions Fig. 3 from Ding et al., 2020
nucleate erythrocyte gsto2 expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
nucleate erythrocyte keap1a expression decreased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
nucleate erythrocyte pgd expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
myeloid cell spi1b expression decreased distribution, abnormal smarca5zko1049a/zko1049a standard conditions Fig. 3 from Ding et al., 2020
caudal vein plexus blood coagulation, fibrin clot formation increased frequency, abnormal smarca5zko1049a/zko1049a standard conditions Figure 1 with image from Ding et al., 2021
erythroid lineage cell gata1a expression decreased distribution, abnormal smarca5zko1049a/zko1049a standard conditions Fig. 3 from Ding et al., 2020
caudal vein plexus tal1 expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 1 with image from Ding et al., 2021
nucleate erythrocyte hmox1a expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
nucleate erythrocyte gstp1.2 expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
nucleate erythrocyte g6pd expression increased amount, abnormal smarca5zko1049a/zko1049a standard conditions Figure 6 with image from Ding et al., 2021
lymphoid progenitor cell rag1 expression decreased distribution, abnormal smarca5zko1049a/zko1049a standard conditions Fig. 3 from Ding et al., 2020
nucleate erythrocyte mitochondrial crista damaged, abnormal smarca5zko1049a/zko1049a standard conditions Figure 3 with image from Ding et al., 2021
nucleate erythrocyte cellular response to oxidative stress increased rate, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg standard conditions Figure 4 with image from Ding et al., 2021
nucleate erythrocyte apoptotic process increased rate, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg standard conditions Figure 4 with image from Ding et al., 2021
nucleate erythrocyte cellular senescence increased rate, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg standard conditions Figure 4 with image from Ding et al., 2021
nucleate erythrocyte chromatin remodeling disrupted, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg standard conditions Figure 5 with image from Ding et al., 2021
nucleate erythrocyte inflammatory response increased rate, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg standard conditions Figure 4 with image from Ding et al., 2021
nucleate erythrocyte DsRed expression spatial pattern, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg; y1Tg/y1Tg standard conditions Figure 1 with image from Ding et al., 2021
nucleate erythrocyte DsRed expression increased amount, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg; y1Tg/y1Tg standard conditions Figure 1 with image from Ding et al., 2021
caudal vein plexus blood coagulation, fibrin clot formation increased frequency, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg; y1Tg/y1Tg standard conditions Figure 2 with image from Ding et al., 2021
caudal vein plexus DsRed expression increased amount, abnormal smarca5zko1049a/zko1049a; sd2Tg/sd2Tg; y1Tg/y1Tg standard conditions Figure 2 with image from Ding et al., 2021
caudal hematopoietic tissue myb expression decreased distribution, abnormal smarca5zko1049a/zko1049a; zf3609Tg standard conditions Fig. 6 from Ding et al., 2020
caudal vein plexus blood coagulation, fibrin clot formation increased frequency, ameliorated smarca5zko1049a/zko1049a + MO2-hmox1a standard conditions Figure 6 with image from Ding et al., 2021
caudal hematopoietic tissue myb expression decreased distribution, abnormal smarca5zko1049a/zko1049a; ioz119Tg control Fig. 3 from Ding et al., 2020
Citations