CRISPR

CRISPR1-vrtn

ID
ZDB-CRISPR-171020-1
Name
CRISPR1-vrtn
Previous Names
None
Target
Sequence
5' - GTCCTGGGGGAGCTGCAGGAGGCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sdu1 vrtn
Expression
Gene expression in Wild Types + CRISPR1-vrtn
No data available
Phenotype
Phenotype resulting from CRISPR1-vrtn
No data available
Phenotype of all Fish created by or utilizing CRISPR1-vrtn
Phenotype Fish Conditions Figures
anatomical structure otx2b expression decreased amount, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
whole organism wholly ventralized, abnormal vrtnsdu1/sdu1 ablation: yolk Fig. 5 with image from Shao et al., 2017
somite decreased amount, abnormal vrtnsdu1/sdu1 standard conditions Fig. S11 with image from Shao et al., 2017
whole organism otx2b expression decreased amount, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
head decreased size, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
head decreased length, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
anatomical structure bmp2b expression increased amount, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
whole organism bmp2b expression increased amount, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
forebrain neural rod six3b expression decreased distribution, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
forebrain neural plate six3b expression decreased distribution, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
optic primordium rx3 expression decreased distribution, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
margin bmp2b expression increased amount, abnormal vrtnsdu1/sdu1 ablation: yolk Fig. 5 with image from Shao et al., 2017
whole organism wholly ventralized, abnormal vrtnsdu1/sdu1 standard conditions Fig. 5 with image from Shao et al., 2017
head decreased size, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
head decreased length, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
forebrain neural rod six3b expression decreased distribution, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
forebrain neural plate six3b expression decreased distribution, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
optic primordium rx3 expression decreased distribution, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
whole organism wholly ventralized, abnormal vrtnsdu1 standard conditions Fig. 5 with image from Shao et al., 2017
Citations