CRISPR

CRISPR1-lpla

ID
ZDB-CRISPR-170913-1
Name
CRISPR1-lpla
Previous Names
  • CRISPR1-lpl
Target
Sequence
5' - GGCTGAAATTGATTATCCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sd51 lpla
Expression
Gene expression in Wild Types + CRISPR1-lpla
No data available
Phenotype
Phenotype resulting from CRISPR1-lpla
No data available
Phenotype of all Fish created by or utilizing CRISPR1-lpla
Phenotype Fish Conditions Figures
thymus rag1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 3 with image from Liu et al., 2018
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 3 with image from Liu et al., 2018
caudal hematopoietic tissue hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal lplasd51/sd51 (AB) chemical treatment by injection: very-low-density lipoprotein Fig. 4 with image from Liu et al., 2018
blood cell decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 2 with image from Liu et al., 2018
whole organism apoc2 expression increased amount, abnormal lplasd51/sd51 (AB) control Fig. 2 with image from Liu et al., 2018
whole organism lipid increased amount, abnormal lplasd51/sd51 (AB) control Fig. S3 with image from Liu et al., 2018
caudal hematopoietic tissue hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal lplasd51/sd51 (AB) chemical treatment by injection: very-low-density lipoprotein Fig. 4 with image from Liu et al., 2018
blood plasma triglyceride increased amount, abnormal lplasd51/sd51 (AB) control Fig. 2 with image from Liu et al., 2018
whole organism hemoglobin decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 2 with image from Liu et al., 2018
thymus lymphocyte rag1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 3 with image from Liu et al., 2018
caudal hematopoietic tissue hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 4 with image from Liu et al., 2018
caudal hematopoietic tissue hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 4 with image from Liu et al., 2018
erythroblast hbbe1.1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 3 with image from Liu et al., 2018
caudal vein blood cell decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 2 with image from Liu et al., 2018
caudal hematopoietic tissue erythroblast hbbe1.1 expression decreased amount, abnormal lplasd51/sd51 (AB) chemical treatment by injection: very-low-density lipoprotein Fig. 4 with image from Liu et al., 2018
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 3 with image from Liu et al., 2018
caudal hematopoietic tissue erythroblast hbbe1.1 expression decreased amount, abnormal lplasd51/sd51 (AB) control Fig. 4 with image from Liu et al., 2018
Citations