CRISPR

CRISPR1-akt2

ID
ZDB-CRISPR-170215-1
Name
CRISPR1-akt2
Previous Names
None
Target
Sequence
5' - GGAGTGGATACGTGCCATCCAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb504 akt2
ihb505 akt2
Expression
Gene expression in Wild Types + CRISPR1-akt2
No data available
Phenotype
Phenotype resulting from CRISPR1-akt2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-akt2
Phenotype Fish Conditions Figures
whole organism nansb expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
blood glucose increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 5 with image from Zhang et al., 2017
whole organism sst2 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism mfap4.1 expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
caudal fin morphogenesis process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
axis decreased length, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism nit1 expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism tet3 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
caudal fin development process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
dorsal fin development process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
pectoral fin morphogenesis process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
whole organism gh1 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism srebf1 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism cbln13 expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism pomca expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism irs4a expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
pectoral fin development process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
muscle ins expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 5 with image from Zhang et al., 2017
heart ins expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 5 with image from Zhang et al., 2017
anal fin morphogenesis process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
dorsal fin morphogenesis process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
whole organism sst1.2 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
liver ins expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 5 with image from Zhang et al., 2017
whole organism sst7 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism mlxipl expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism c1qtnf1 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism viability, abnormal akt2ihb504/ihb504 standard conditions Fig. 2 from Zhang et al., 2017
whole organism decreased weight, abnormal akt2ihb504/ihb504 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism kyat3.2 expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
anal fin development process quality, abnormal akt2ihb504/ihb504 standard conditions Fig. 4 with image from Zhang et al., 2017
whole organism akt2 expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism apoa4a expression decreased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
whole organism akt3b expression increased amount, abnormal akt2ihb504/ihb504 standard conditions Fig. 6 from Zhang et al., 2017
blood glucose increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 5 with image from Zhang et al., 2017
whole organism sst2 expression increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 3 with image from Zhang et al., 2017
caudal fin morphogenesis process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
caudal fin development process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
pectoral fin morphogenesis process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
dorsal fin development process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
whole organism gh1 expression increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism pomca expression increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 3 with image from Zhang et al., 2017
heart ins expression decreased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 5 with image from Zhang et al., 2017
muscle ins expression decreased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 5 with image from Zhang et al., 2017
pectoral fin development process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
anal fin morphogenesis process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
dorsal fin morphogenesis process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
liver ins expression decreased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 5 with image from Zhang et al., 2017
whole organism sst7 expression increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism sst1.2 expression increased amount, abnormal akt2ihb505/ihb505 standard conditions Fig. 3 with image from Zhang et al., 2017
whole organism viability, abnormal akt2ihb505/ihb505 standard conditions Fig. 2 from Zhang et al., 2017
anal fin development process quality, abnormal akt2ihb505/ihb505 standard conditions Fig. 4 with image from Zhang et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.