CRISPR

CRISPR1-sigmar1

ID

ZDB-CRISPR-160831-3

Name

CRISPR1-sigmar1

Previous Names

None

Target

sigmar1 (1)

Sequence

5' - GGCCTTCTCTAAGGTGGTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
f19	sigmar1
f20	sigmar1

Expression

Gene expression in Wild Types + CRISPR1-sigmar1

No data available

Phenotype

Phenotype resulting from CRISPR1-sigmar1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-sigmar1

Phenotype	Fish	Conditions	Figures
whole organism ddit3 expression increased amount, abnormal	sigmar1^f19/f19	control	Figure 4 , Figure 5 from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal	sigmar1^f19/f19	control	Figure 1 , Figure 5 from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
regulation of mitochondrial ATP synthesis coupled proton transport decreased process quality, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 7 from Crouzier et al., 2021
whole organism eif2s1a expression decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
whole organism xbp1 expression increased amount, abnormal	sigmar1^f19/f19	control	Figure 5 from Crouzier et al., 2021
whole organism xbp1 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
retinal rod cell decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 3 from Crouzier et al., 2021
whole organism atf4b expression decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
whole organism xbp1 expression decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
whole organism ddit3 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
cellular respiration decreased process quality, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 7 from Crouzier et al., 2021
whole organism hsp90b1 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
whole organism Ab6-eif2a labeling decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Fig. S20 from Rennekamp et al., 2016
whole organism ern2 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
whole organism Ab11-hspa5 labeling decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
ATP biosynthetic process decreased process quality, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 7 from Crouzier et al., 2021
whole organism atf4b expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
retinal ganglion cell decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 3 from Crouzier et al., 2021
whole organism ern2 expression decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 4 from Crouzier et al., 2021
whole organism atf6 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
whole organism Ab3-sigmar1 labeling decreased amount, abnormal	sigmar1^f19/f19	standard conditions	Figure 1 from Crouzier et al., 2021
swimming behavior increased process quality, abnormal	sigmar1^f19/f19	altered light dark cycle	Figure 2 from Crouzier et al., 2021
ATP biosynthetic process decreased process quality, abnormal	sigmar1^f19/f19	control	Figure 6 , Figure 7 from Crouzier et al., 2021
cellular respiration decreased process quality, abnormal	sigmar1^f19/f19	control	Figure 6 , Figure 7 from Crouzier et al., 2021
whole organism hspa5 expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
whole organism atf4a expression increased amount, abnormal	sigmar1^f19/f19	chemical treatment by environment: tunicamycin	Figure 5 from Crouzier et al., 2021
whole organism sigmar1 expression decreased amount, abnormal	sigmar1^f20/f20	standard conditions	Fig. S20 from Rennekamp et al., 2016

Citations