CRISPR

CRISPR1-gmnc

ID

ZDB-CRISPR-160616-1

Name

CRISPR1-gmnc

Previous Names

None

Target

gmnc (1)

Sequence

5' - GCTGGTCTCCCTCTGGGACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sq34	gmnc

Expression

Gene expression in Wild Types + CRISPR1-gmnc

No data available

Phenotype

Phenotype resulting from CRISPR1-gmnc

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gmnc

Phenotype	Fish	Conditions	Figures
telencephalic ventricle increased size, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 7 from D'Gama et al., 2021
choroid plexus anterior region foxj1b expression decreased amount, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from D'Gama et al., 2021
fourth ventricle lacks all parts of type multi-ciliated epithelial cell, abnormal	gmnc^sq34/sq34	standard conditions	Fig. S3 from D'Gama et al., 2021
peripheral olfactory organ lateral side foxj1b expression absent, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from Chong et al., 2018
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 8 from Lu et al., 2019 Fig. 1 from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 1 from Zhou et al., 2015
choroid plexus anterior region foxj1a expression decreased amount, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from D'Gama et al., 2021
dorsal telencephalon lacks all parts of type multi-ciliated epithelial cell, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from D'Gama et al., 2021
choroid plexus lacks all parts of type multi-ciliated epithelial cell, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from D'Gama et al., 2021
choroid plexus anterior region gmnc expression decreased amount, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from D'Gama et al., 2021
peripheral olfactory organ lateral side foxj1a expression absent, abnormal	gmnc^sq34/sq34	standard conditions	Fig. 4 from Chong et al., 2018
choroid plexus motile cilium decreased amount, abnormal	gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
tela chorioidea motile cilium decreased amount, abnormal	gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 5 from D'Gama et al., 2021
telencephalon EGFP expression decreased amount, abnormal	gmnc^sq34/sq34; foxj1b^tsu10Gt	standard conditions	Fig. 4 from D'Gama et al., 2021
telencephalon EGFP expression spatial pattern, abnormal	gmnc^sq34/sq34; foxj1b^tsu10Gt	standard conditions	Fig. 4 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/+; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/+; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^sq5719/+	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^sq5719/+	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column rotational curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021
vertebral column increased curvature, abnormal	foxj1a^sq5717/+; gmnc^sq34/sq34; foxj1b^{sq5719/sq5719}	standard conditions	Fig. 7 from D'Gama et al., 2021

Citations