Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	40.6 cM	z4300	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
2	68.8 cM	z4300	Mother of Pearl (MOP)	Postlethwait, John H.	Data
2	215.19 cR	Z4300	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
2	2194.0 cR	z4300	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z9354	SSLP	2		Fraenkel et al., 2009	Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.
tzhe067	Feature	2		Fraenkel et al., 2009	Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.
z26250	SSLP	2		Fraenkel et al., 2009	Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.
atp1b3a	GENE	2		Rajarao et al., 2001	Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1b3a to LG02 between z4733 and z4300. atp1b3a was previously mapped to LG02 on the T51 mapping panel.
z4733	SSLP	2		Rajarao et al., 2001	Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1b3a to LG02 between z4733 and z4300. atp1b3a was previously mapped to LG02 on the T51 mapping panel.
tu25f	Feature	2		Wingert et al., 2004	Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and  ... Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and z7634, ~2.7 cM north of z7634.
z7634	SSLP	2		Wingert et al., 2004	Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and  ... Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and z7634, ~2.7 cM north of z7634.

OTHER MAPPING INFORMATION

Chr 2 Rajarao et al., 2001 Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res  ... Using one or more of the T51, LN54, or Heat Shock mapping panels, Rajarao, et al. (2001. Genome Res 11:1211-1220.) confirm the location of atp1b3a to LG02 between z4733 and z4300. atp1b3a was previously mapped to LG02 on the T51 mapping panel.   Chr 2 Wingert et al., 2004 Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and z7634, ~2.7 cM north  ... Wingert, et al. (2004) mapped the chianti locus between SSLP markers z4300 and z7634, ~2.7 cM north of z7634.   Chr 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	155
Forward Primer	TTTGGTGCACAAATGAAGGCC
Reverse Primer	CAAAAAGGGCATCGGTGCAT
AB	145,177
Forward Primer	TTTGGTGCACAAATGAAGGCC
Reverse Primer	CAAAAAGGGCATCGGTGCAT