Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 3 23,641,935 - 23,643,830 GRCz11 Ensembl 3 23,641,935 - 23,643,830 GRCz11 Vega 3 23,511,387 - 23,513,282 GRCv10 NCBI Map Viewer 3 23,641,935 - 23,643,808 GRCz11 UCSC 3 - GRCz11

Mapped Clones containing eve1
CH211-72A16	Chr: 3 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
3	46.0 cM	eve1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
3	162.38 cR	eve1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
3	44.1 cM	eve1	Heat Shock (HS)	Woods, Ian G.	Data
3	54.66 cM	eve1	Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
hoxb5a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb1a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb2a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb3a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb4a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb6a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb8a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb9a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb7a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.
hoxb10a	GENE	3		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.

OTHER MAPPING INFORMATION

Chr 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1, hoxb10a, hoxb9a, hoxb8a, hoxb7a, hoxb6a, hoxb5a, hoxb4a, hoxb3a, hoxb2a, and hoxb1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG03.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	580	Sau96I	36.0
Forward Primer	CTACTGAATGGTATCGACCAAA
Reverse Primer	ACGTTGTCTCTTGTCCTTCATT