ZFIN ID: ZDB-GENE-980526-176 |
Gene Name: | cyclin D1 |
---|---|
Symbol: | ccnd1 |
PHYSICAL MAP AND BROWSER
|
Mapped Clones containing ccnd1 | |
---|---|
CH211-188I17 | Chr: 7 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa14707 | 7 | 54,675,331 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 54,405,679 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 54,579,403 | Zv9 | Busch-Nentwich et al., 2013 | |
sa21083 | 7 | 54,677,030 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 54,407,378 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 54,577,704 | Zv9 | Busch-Nentwich et al., 2013 | |
sa34190 | 7 | 54,675,549 | GRCz11 | Busch-Nentwich et al., 2013 |
7 | 54,405,897 | GRCz10 | Busch-Nentwich et al., 2013 | |
7 | 54,579,185 | Zv9 | Busch-Nentwich et al., 2013 | |
la016165Tg | 7 | 54,575,397 - 54,575,407 | Zv9 | |
la016166Tg | 7 | 54,575,856 - 54,575,866 | Zv9 | |
la026147Tg | 7 | 54,575,688 - 54,575,698 | Zv9 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
7 | 147.6 cM | cycd1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
7 | 264.13 cR | cycD1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
7 | 5890.0 cR | cycd1 | Goodfellow T51 (T51) | Geisler, Robert | Data |
7 | 127.9 cM | cnnd1 | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
fgf19 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... | |
lto1 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... | |
fgf4 | GENE | unknown | Katoh et al., 2003 | Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, ... |
|
Markers Encoded by ccnd1 | ||
---|---|---|
fb52e01 Chr: 7 Details | ||
fc45c08 Chr: 7 Details | ||
fc83a12 Chr: 7 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 979 | AciI | 36.0 |
Forward Primer | ACGTGGACCTCTCTTGCACT | ||
Reverse Primer | TCAGCCTTAAACGACGGACT |