Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 7 54,605,640 - 54,609,108 GRCz11 Ensembl 7 54,605,640 - 54,609,108 GRCz11 Vega 7 54,335,988 - 54,339,456 GRCv10 NCBI Map Viewer 7 54,606,242 - 54,608,594 GRCz11 UCSC 7 - GRCz11

Mapped Clones containing fgf3
CH211-96B20	Chr: 7 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	151.2 cM	fgf3	Mother of Pearl (MOP)	Postlethwait, John H.	Data
7	262.32 cR	fgf3	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	5890.0 cR	fgf3	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
t24152	Feature	7		Herzog et al., 2004	Using bulk segregation analysis and further fine mapping, lia was mapped to  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.
z41496	SSLP	7		Herzog et al., 2004	Using bulk segregation analysis and further fine mapping, lia was mapped to  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.
z41496	SSLP	7		Herzog et al., 2004	Using bulk segregation analysis and further fine mapping, lia was mapped to  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.
z8540	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20576	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z20715	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3445	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7244	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z26442	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fd21a02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64c10	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fi19d09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64f09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb12g02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fa11d03	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fc89b01	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14644	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.

OTHER MAPPING INFORMATION

Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.   Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.   Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.

Genomic Feature t24152 is an allele of fgf3

Marker Type Chr Distance Publication / Person Comments fgf3 GENE 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.   z41496 SSLP 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.

Genomic Feature t24152 is an allele of fgf3

Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ... Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or meiotic mapping as reported in Herzog et al. 2004 (Mol. Endo. 18(5):1185-1195.   Chr 7 Herzog et al., 2004 Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7,  ... Using bulk segregation analysis and further fine mapping, lia was mapped to linkage group 7, approximately 62 cM from the top of LG7, between the markers z41496 and z64508.

Genomic Feature t21142 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ... Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or meiotic mapping as reported in Herzog et al. 2004 (Mol. Endo. 18(5):1185-1195.

Genomic Feature t26212 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ... Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or meiotic mapping as reported in Herzog et al. 2004 (Mol. Endo. 18(5):1185-1195.

Genomic Feature t24149 is an allele of fgf3
Chr 7 Herzog et al., 2004 Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or  ... Allelism of t21142, t24149, t24152, and t26212 was determined by complementation crossing or meiotic mapping as reported in Herzog et al. 2004 (Mol. Endo. 18(5):1185-1195.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	611	Mnl1	36.0
Forward Primer	CTCCATTACTAGCATGCGCA
Reverse Primer	CTCATGAATGCGCTCCAGAA