ZFIN ID: ZDB-GENE-980526-485 |
Gene Name: | POU domain, class 5, transcription factor 3 |
---|---|
Symbol: | pou5f3 |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing pou5f3 | |
---|---|
CH73-205E12 | Chr: 21 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
e713 | 21 | 13,687,101 | GRCz11 | Burgess et al., 2002 |
hi349Tg | 21 | 13,689,438 - 13,689,439 | GRCz11 | ZFIN Curated Data |
hi1757Tg | 21 | 13,692,718 - 13,692,719 | GRCz11 | ZFIN Curated Data |
hi1940Tg | 21 | 13,690,021 - 13,690,022 | GRCz11 | ZFIN Curated Data |
ihb137 | 21 | 13,689,976 - 13,689,979 | GRCz11 | Zhang et al., 2020 |
m216 | 21 | 13,687,101 | GRCz11 | Belting et al., 2001 |
sa1294 | 21 | 13,687,075 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 13,590,346 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 11,889,172 | Zv9 | Busch-Nentwich et al., 2013 | |
sa1329 | 21 | 13,690,432 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 13,593,703 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 11,892,529 | Zv9 | Busch-Nentwich et al., 2013 | |
la013973Tg | 21 | 11,890,655 - 11,890,665 | Zv9 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
21 | 57.8 cM | pou2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
21 | 1331.0 cR | pou2 | Goodfellow T51 (T51) | Geisler, Robert | Data |
21 | 50.3 cM | pou2 | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Markers Encoded by pou5f3 | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
chunp6868 Chr: 21 Details | ||||||||||||||||||||
fd18d06 Chr: 21 Details |
Genomic Feature m793 is an allele of pou5f3 | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Genomic Feature e713 is an allele of pou5f3 | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Genomic Feature m793 is an allele of pou5f3 | |||
---|---|---|---|
|
Genomic Feature e713 is an allele of pou5f3 | |||
---|---|---|---|
|
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 796 | BfaI | 36.0 |
Forward Primer | GCCCTTTGATGACGAGTGTG | ||
Reverse Primer | TTGGAGATGGGAGAGTGCAA |
Genomic Feature hi1940Tg is an allele of pou5f3 |