TALEN

TALEN1-knl1

ID
ZDB-TALEN-201201-2
Name
TALEN1-knl1
Previous Names
None
Target
Target Sequence 1
5' - TTTGAAAGCTCCTCGAACAT - 3'
Target Sequence 2
5' - TTGCTCCTCTTGCTCAACTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ulb10 knl1
ulb9 knl1
Expression
Gene expression in Wild Types + TALEN1-knl1
No data available
Phenotype
Phenotype resulting from TALEN1-knl1
No data available
Phenotype of all Fish created by or utilizing TALEN1-knl1
Phenotype Fish Conditions Figures
whole organism viability, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism decreased length, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
head decreased size, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
pericardium edematous, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism curved, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal knl1ulb9/ulb9 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism viability, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism decreased length, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
head decreased size, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
pericardium edematous, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism curved, abnormal knl1ulb10/ulb10 standard conditions Fig. 3 from Duerinckx et al., 2019
whole organism decreased length, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism curved, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
head decreased size, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism viability, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
pericardium edematous, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased life span, abnormal aspmulb7/+; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased length, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism curved, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
head decreased size, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism viability, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased life span, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
pericardium edematous, abnormal aspmulb7/ulb7; knl1ulb9/ulb9 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased length, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism curved, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
head decreased size, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism viability, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased life span, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
pericardium edematous, abnormal aspmulb8/+; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased length, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism curved, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
head decreased size, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism viability, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism decreased life span, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
pericardium edematous, abnormal aspmulb8/ulb8; knl1ulb10/ulb10 standard conditions Fig. S2 from Duerinckx et al., 2019
whole organism curved, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal wdr62ulb11/+; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal wdr62ulb11/ulb11; knl1ulb9/ulb9 standard conditions Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal wdr62ulb12/+; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
head decreased size, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism viability, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased length, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
pericardium edematous, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism decreased life span, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
whole organism curved, abnormal wdr62ulb12/ulb12; knl1ulb10/ulb10 standard conditions Fig. S3 from Duerinckx et al., 2019
Citations