TALEN

TALEN2-f2rl1.2

ID
ZDB-TALEN-180712-2
Name
TALEN2-f2rl1.2
Previous Names
None
Target
Target Sequence 1
5' - TATGGCGAGGAGATGTGCAA - 3'
Target Sequence 2
5' - CTTCTACGGGAACATGTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sfc18b f2rl1.2
Expression
Gene expression in Wild Types + TALEN2-f2rl1.2
No data available
Phenotype
Phenotype resulting from TALEN2-f2rl1.2
No data available
Phenotype of all Fish created by or utilizing TALEN2-f2rl1.2
Phenotype Fish Conditions Figures
epidermal basal stratum cell motility increased occurrence, abnormal f2rl1.2sfc18b/sfc18b; cy34Tg standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, abnormal f2rl1.2sfc18b/sfc18b; cy34Tg standard conditions Fig. 6 with image from Schepis et al., 2018
whole organism mmp13a.1 expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
integument cell aggregated, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 2 with image from Schepis et al., 2018
whole organism il1b expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression amount, ameliorated f2rl1.2sfc18b/sfc18b + MO1-spint1a standard conditions Fig. 7 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy22Tg + MO1-spint1a standard conditions Fig. 3 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell-cell junction ab2-cdh1 labeling position, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 5 with image from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, exacerbated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 6 with imageFig. 8 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated f2rl1.2sfc18b/sfc18b; la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; la213Tg; mu271Tg + MO1-spint1a standard conditions Fig. 4 with image from Schepis et al., 2018
epithelial cell protruding out of epidermal superficial stratum, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a standard conditions Fig. 8 from Schepis et al., 2018
epidermal basal stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-erbb2 + MO1-spint1a chemical treatment: PD 168393 Fig. 8 from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
Citations