TALEN

TALEN1-mespbb

ID

ZDB-TALEN-161013-4

Name

TALEN1-mespbb

Previous Names

None

Target

mespbb (1)

Target Sequence 1

5' - CCTAGTAAACAAAGACA - 3'

Target Sequence 2

5' - CCCTCATTCTCAGCTTCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
kt1006	mespbb
kt1009	mespbb

Expression

Gene expression in Wild Types + TALEN1-mespbb

No data available

Phenotype

Phenotype resulting from TALEN1-mespbb

No data available

Phenotype of all Fish created by or utilizing TALEN1-mespbb

Phenotype	Fish	Conditions	Figures
iridophore patchy, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 7 from Yabe et al., 2016
posterior lateral line development process quality, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 7 from Yabe et al., 2016
somite pax7a expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
somite tbx18 expression absent, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite pax7a expression decreased amount, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
somite shape, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 , Fig. 6 from Yabe et al., 2016
somite 1 lacks all parts of type somite border, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 from Yabe et al., 2016
somite ripply1 expression decreased amount, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 3 from Yabe et al., 2016
horizontal myoseptum absent, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
somite myod1 expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite fgf8a expression absent, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite tbx18 expression decreased amount, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
hemal arch duplicated, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite border ab2-fn labeling spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 4 from Yabe et al., 2016
somite 2 lacks all parts of type somite border, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 from Yabe et al., 2016
somite 4 lacks parts or has fewer parts of type somite border, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 from Yabe et al., 2016
somite border extracellular matrix organization disrupted, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 4 from Yabe et al., 2016
larval melanophore stripe spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 7 from Yabe et al., 2016
slow muscle cell morphology, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
posterior lateral line mislocalised ventrally, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 7 from Yabe et al., 2016
somite 1 ripply1 expression decreased amount, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 3 from Yabe et al., 2016
somite 5 lacks parts or has fewer parts of type somite border, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 from Yabe et al., 2016
neural arch bifurcated, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
horizontal myoseptum smyhc1 expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
somite uncx4.1 expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite 3 lacks all parts of type somite border, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 2 from Yabe et al., 2016
somite rostral/caudal axis specification disrupted, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite border extracellular matrix patchy, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 4 from Yabe et al., 2016
somite uncx4.1 expression decreased amount, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 5 from Yabe et al., 2016
somite superficial region smyhc1 expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
paraxial mesoderm epha4a expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 4 from Yabe et al., 2016
muscle pioneer mislocalised medially, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016
horizontal myoseptum cxcl12a expression spatial pattern, abnormal	mespbb^{kt1009/kt1009}; mespaa^{kt1017/kt1017}; mespab^{kt1002/kt1002}; mespba^{kt1004/kt1004}	standard conditions	Fig. 6 from Yabe et al., 2016

Citations