TALEN

TALEN1-cavin4b

ID
ZDB-TALEN-160819-1
Name
TALEN1-cavin4b
Previous Names
  • TALEN1-murcb
Target
Target Sequence 1
5' - TCTCTCTGCTGGAGAGGGTGT - 3'
Target Sequence 2
5' - GGCAGGCCTGAACATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
s983 cavin4b
Expression
Gene expression in Wild Types + TALEN1-cavin4b
No data available
Phenotype
Phenotype resulting from TALEN1-cavin4b
No data available
Phenotype of all Fish created by or utilizing TALEN1-cavin4b
Phenotype Fish Conditions Figures
skeletal muscle cell cytoplasm ab1-cav1 labeling increased amount, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
skeletal muscle ab9-mapk labeling increased amount, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
skeletal muscle cell sarcomere ab1-cav1 labeling spatial pattern, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
skeletal muscle cell decreased diameter, abnormal cavin4bs983/s983 standard conditions Fig. 2 with imageFig. 3 with image from Housley et al., 2016
skeletal muscle ab13-mapk labeling decreased amount, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
skeletal muscle cell has extra parts of type skeletal muscle cell caveola, abnormal cavin4bs983/s983 standard conditions Fig. 6 with image from Housley et al., 2016
male organism decreased length, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
skeletal muscle cell T-tubule malformed, abnormal cavin4bs983/s983 standard conditions Fig. 6 with image from Housley et al., 2016
skeletal muscle cell cytoplasm ab1-cav1 labeling mislocalised, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
skeletal muscle Ab1-murc labeling decreased amount, abnormal cavin4bs983/s983 standard conditions Fig. 1 with image from Housley et al., 2016
female organism decreased length, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
male organism decreased mass, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
skeletal muscle cell T-tubule organization decreased process quality, abnormal cavin4bs983/s983 standard conditions Fig. 6 with image from Housley et al., 2016
skeletal muscle cell increased variability of size, abnormal cavin4bs983/s983 standard conditions Fig. 2 with imageFig. 3 with image from Housley et al., 2016
skeletal muscle ERK1 and ERK2 cascade occurrence, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
swimming decreased process quality, abnormal cavin4bs983/s983 standard conditions Fig. 4 with image from Housley et al., 2016
skeletal muscle cell cytoplasm Ab1-cav3 labeling decreased amount, abnormal cavin4bs983/s983 standard conditions Fig. 7 with image from Housley et al., 2016
female organism decreased mass, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
skeletal muscle degenerate, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
skeletal muscle cell irregularly shaped, abnormal cavin4bs983/s983 standard conditions Fig. 2 with image from Housley et al., 2016
Citations