TALEN

TALEN2-tcf21

ID

ZDB-TALEN-160311-1

Name

TALEN2-tcf21

Previous Names

None

Target

tcf21 (1)

Target Sequence 1

5' - TCTCCAGCCAACATGT - 3'

Target Sequence 2

5' - TCGTGAAATTCATCCACATCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sk1	tcf21

Expression

Gene expression in Wild Types + TALEN2-tcf21

No data available

Phenotype

Phenotype resulting from TALEN2-tcf21

No data available

Phenotype of all Fish created by or utilizing TALEN2-tcf21

Phenotype	Fish	Conditions	Figures
hypobranchial artery DsRed2 expression absent, abnormal	tcf21^sk1/sk1; fb7Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
pharyngeal vasculature DsRed2 expression absent, abnormal	tcf21^sk1/sk1; fb7Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
cranial vasculature DsRed2 expression absent, abnormal	tcf21^sk1/sk1; fb7Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
aortic arch 6 blood vessel lumenization arrested, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 4 ZsYellow expression decreased amount, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 5 blood vessel lumenization decreased occurrence, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery shape, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 3 ZsYellow expression decreased amount, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 3 blood vessel lumenization decreased occurrence, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 6 ZsYellow expression decreased amount, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 4 blood vessel lumenization decreased occurrence, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 5 ZsYellow expression decreased amount, abnormal	tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery shape, abnormal	tcf21^sk1/sk1; la116Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
pharyngeal vasculature DsRed2 expression absent, abnormal	tcf21^sk1/sk1; la116Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal	tcf21^sk1/sk1; la116Tg; pd37Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
intermandibularis hypoplastic, abnormal	tcf21^sk1/sk1; pd37Tg; zf13Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
interhyoideus hypoplastic, abnormal	tcf21^sk1/sk1; pd37Tg; zf13Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
head muscle aplastic/hypoplastic, abnormal	tcf21^sk1/sk1; pd37Tg; zf13Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
pharyngeal musculature absent, abnormal	tcf21^sk1/sk1; pd37Tg; zf13Tg	standard conditions	Fig. 4 from Nagelberg et al., 2015
aortic arch 6 blood vessel lumenization arrested, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
pharyngeal vasculature endothelial cell migration process quality, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 6 from Nagelberg et al., 2015
hypobranchial artery mCherry expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery detached from lateral dorsal aorta, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 5 blood vessel lumenization arrested, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 3 ZsYellow expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 4 ZsYellow expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 5 ZsYellow expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 6 ZsYellow expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
aortic arch 4 blood vessel lumenization decreased occurrence, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015
hypobranchial artery ZsYellow expression absent, abnormal	nkx2.5^vu179/vu179; tcf21^sk1/sk1; fb7Tg; s896Tg	standard conditions	Fig. 5 from Nagelberg et al., 2015

Citations