TALEN

TALEN1-tet3

ID

ZDB-TALEN-151217-5

Name

TALEN1-tet3

Previous Names

None

Target

tet3 (1)

Target Sequence 1

5' - TGACCGCACTCACCCA - 3'

Target Sequence 2

5' - TTCTTGTGCTGGTAGAAGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mk18	tet3

Expression

Gene expression in Wild Types + TALEN1-tet3

No data available

Phenotype

Phenotype resulting from TALEN1-tet3

No data available

Phenotype of all Fish created by or utilizing TALEN1-tet3

Phenotype	Fish	Conditions	Figures
eye gnb3a expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Gore et al., 2018
brain morphology, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Li et al., 2015
trunk curved, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Li et al., 2015
whole organism decreased life span, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	text only from Gore et al., 2018
trunk gata2b expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 6 from Li et al., 2015
atrioventricular canal bmp4 expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 4 , Fig. 5 from Lan et al., 2019
eye decreased size, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Gore et al., 2018 Fig. 1 from Li et al., 2015
thymus T cell rag1 expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Li et al., 2015
heart chromosomal 5-methylcytosine DNA demethylation pathway decreased process quality, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3, Fig. 5 from Lan et al., 2019
dorsal aorta runx1 expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	control	Fig. 6 from Li et al., 2015
dorsal aorta tal1 expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 6 from Li et al., 2015
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Li et al., 2015
dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Li et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Li et al., 2015
eye DNA-methyltransferase activity increased occurrence, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Gore et al., 2018
proepicardial cluster wt1a expression decreased distribution, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Lan et al., 2019
eye crx expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 3 from Gore et al., 2018
brain development disrupted, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	text only from Gore et al., 2018
pigmentation process quality, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Li et al., 2015
atrioventricular canal has2 expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 4 , Fig. 5 from Lan et al., 2019
proepicardial cluster wt1a expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Lan et al., 2019
heart inhbaa expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 5 from Lan et al., 2019
heart sox9b expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 5 from Lan et al., 2019
atrioventricular canal vcana expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 6 from Lan et al., 2019
atrioventricular canal endocardium GFP expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; ia4Tg	standard conditions	Fig. 4 from Lan et al., 2019
Wnt signaling pathway involved in heart development decreased process quality, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; ia4Tg	standard conditions	Fig. 4 from Lan et al., 2019
macrophage EGFP expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; nz117Tg	standard conditions	Fig. 3 from Li et al., 2015
neutrophil EGFP expression absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; nz117Tg	standard conditions	Fig. 3 from Li et al., 2015
proepicardium cell migration involved in pericardium morphogenesis disrupted, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; pd41Tg	standard conditions	Fig. 1 from Lan et al., 2019
proepicardial cluster EGFP expression mislocalised, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; pd41Tg	standard conditions	Fig. 1 from Lan et al., 2019
proepicardium cell migration involved in pericardium morphogenesis decreased occurrence, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; pd41Tg	standard conditions	Fig. 1 from Lan et al., 2019
proepicardium cell migration involved in pericardium morphogenesis occurrence, ameliorated	tet2^mk17/mk17; tet3^mk18/mk18; pd41Tg	chemical treatment by environment: 5-aza-2'-deoxycytidine	Fig. 1 from Lan et al., 2019
atrioventricular valve absent, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; ubs1Tg	standard conditions	Fig. 4 from Lan et al., 2019
dorsal aorta ventral region EGFP expression decreased amount, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; um14Tg	standard conditions	Fig. 7 from Li et al., 2015
brain morphology, abnormal	tet1^mk16/mk16; tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Li et al., 2015
eye decreased size, abnormal	tet1^mk16/mk16; tet2^mk17/mk17; tet3^mk18/mk18	standard conditions	Fig. 1 from Li et al., 2015
dorsal aorta nucleus broken, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; mu122Tg; s896Tg	standard conditions	Fig. 5 from Li et al., 2015
endothelial to hematopoietic transition decreased occurrence, abnormal	tet2^mk17/mk17; tet3^mk18/mk18; mu122Tg; s896Tg	standard conditions	Fig. 5 from Li et al., 2015

Citations