TALEN

TALEN2-adgrg6

ID

ZDB-TALEN-150715-1

Name

TALEN2-adgrg6

Previous Names

gpr126 (1)

Target

adgrg6 (1)

Target Sequence 1

5' - TGACTACCCACCCAGCCAGTC - 3'

Target Sequence 2

5' - TATAAAGCCAGCCGGGGCCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
stl47	adgrg6

Expression

Gene expression in Wild Types + TALEN2-adgrg6

No data available

Phenotype

Phenotype resulting from TALEN2-adgrg6

No data available

Phenotype of all Fish created by or utilizing TALEN2-adgrg6

Phenotype	Fish	Conditions	Figures
posterior lateral line nerve mbpa expression absent, abnormal	adgrg6^stl47/stl47	chemical treatment by environment: undecenoic acid	Fig. 3 from Bradley et al., 2019
posterior lateral line peripheral nervous system myelin formation decreased process quality, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line nerve mbpa expression absent, abnormal	adgrg6^stl47/stl47	chemical treatment by environment: naloxone hydrochloride	Fig. 3 from Bradley et al., 2019
posterior lateral line nerve mbpa expression amount, ameliorated	adgrg6^stl47/stl47	chemical treatment by environment: telmisartan	Fig. 3 from Bradley et al., 2019
posterior lateral line nerve mbpa expression absent, abnormal	adgrg6^stl47/stl47	control	Fig. 3 from Bradley et al., 2019
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^stl47/stl47	chemical treatment: forskolin	Fig. 2 from Petersen et al., 2015
posterior lateral line peripheral nervous system axon ensheathment arrested, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^stl47/stl47	control	Fig. 1 , Fig. 2 from Petersen et al., 2015
posterior lateral line peripheral nervous system axon ensheathment arrested, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line peripheral nervous system myelin formation decreased process quality, abnormal	adgrg6^stl47/stl47	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^st49/+; adgrg6^stl47/+	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line Schwann cell development decreased process quality, abnormal	adgrg6^st49/+; adgrg6^stl47/+	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line peripheral nervous system myelin formation decreased process quality, abnormal	adgrg6^st49/+; adgrg6^stl47/+	standard conditions	Fig. 1 from Petersen et al., 2015
posterior lateral line myelination of posterior lateral line nerve axons arrested, abnormal	adgrg6^stl47/stl47; vu234Tg	control	Fig. 2 from Petersen et al., 2015

Citations