TALEN

TALEN2-foxc1a

ID

ZDB-TALEN-150624-2

Name

TALEN2-foxc1a

Previous Names

None

Target

foxc1a (1)

Target Sequence 1

5' - CTCACGCGGCCCACGACCAGT - 3'

Target Sequence 2

5' - GTATGGCCCATATGCCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nju19	foxc1a

Expression

Gene expression in Wild Types + TALEN2-foxc1a

No data available

Phenotype

Phenotype resulting from TALEN2-foxc1a

No data available

Phenotype of all Fish created by or utilizing TALEN2-foxc1a

Phenotype	Fish	Conditions	Figures
bulbus arteriosus shortened, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
presumptive cardiac ventricle heart tube decreased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
atrioventricular canal tbx2b expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
heart contraction disrupted, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
cardiac ventricle decreased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
whole organism nkx2.5 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
whole organism tal1 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
heart edematous, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Li et al., 2015
cardiac ventricle vcana expression spatial pattern, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
lateral plate mesoderm nkx2.5 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
atrium increased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
presumptive atrium heart tube myh6 expression increased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
pericardium edematous, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1, Fig. S1 from Yue et al., 2017
blood hbae1.1 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S3 from Yue et al., 2017
whole organism etsrp expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
atrioventricular canal nppa expression spatial pattern, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
somitogenesis process quality, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2, Fig. 3 from Li et al., 2015
somite decreased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Li et al., 2015
eye decreased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S1 from Yue et al., 2017
presumptive atrium heart tube myh6 expression increased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
atrium myh6 expression increased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
atrioventricular canal nppa expression increased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
atrioventricular canal bmp4 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
cardiac ventricle myh7 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
lateral plate mesoderm etsrp expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
atrioventricular canal endothelial cell mislocalised, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
presumptive atrium heart tube increased size, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
atrioventricular valve morphology, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
cardiac ventricle myh7 expression decreased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
pericardium decreased thickness, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
cardiac ventricle vcana expression increased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
heart contraction decreased occurrence, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
blood hbae1.1 expression decreased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S3 from Yue et al., 2017
lateral plate mesoderm tal1 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 3 from Yue et al., 2017
whole organism decreased length, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S1 from Yue et al., 2017 Fig. 2 from Li et al., 2015
presumptive cardiac ventricle heart tube myh7 expression decreased distribution, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
myocardium decreased thickness, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 1 from Yue et al., 2017
atrium myh6 expression increased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
erythrocyte development disrupted, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S3 from Yue et al., 2017
presumptive cardiac ventricle heart tube myh7 expression decreased amount, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. 2 from Yue et al., 2017
blood hbae1.1 expression spatial pattern, abnormal	foxc1a^nju19/nju19	standard conditions	Fig. S3 from Yue et al., 2017
atrium increased size, abnormal	foxc1a^nju19/nju19; s843Tg	standard conditions	Fig. 2 from Yue et al., 2017
cardiac ventricle decreased size, abnormal	foxc1a^nju19/nju19; s843Tg	standard conditions	Fig. 2 from Yue et al., 2017

Citations