Morpholino

MO2-bin1b

ID
ZDB-MRPHLNO-250108-1
Name
MO2-bin1b
Previous Names
None
Target
Sequence
5' - TCTCTTATTATTGGCCTCACTTTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bin1b
Expressed Gene Anatomy Figures
bin1b Fig. 2 from Smith et al., 2014
Phenotype
Phenotype resulting from MO2-bin1b
Phenotype Fish Figures
post-vent region bent, abnormal AB + MO2-bin1b Fig. 3 from Smith et al., 2014
post-vent region curved dorsal, abnormal AB + MO2-bin1b Fig. 3 from Smith et al., 2014
post-vent region kinked, abnormal AB + MO2-bin1b Fig. 3 from Smith et al., 2014
skeletal muscle nucleolus low brightness, abnormal AB + MO2-bin1b Fig. 4 from Smith et al., 2014
skeletal muscle nucleus aggregated, abnormal AB + MO2-bin1b Fig. 4 from Smith et al., 2014
skeletal muscle nucleus circular, abnormal AB + MO2-bin1b Fig. 4 from Smith et al., 2014
skeletal muscle nucleus increased size, abnormal AB + MO2-bin1b Fig. 4 from Smith et al., 2014
skeletal muscle nucleus mislocalised, abnormal AB + MO2-bin1b Fig. 4 from Smith et al., 2014
skeletal muscle cell disorganized, abnormal AB + MO2-bin1b Fig. 4,  Fig. 7 from Smith et al., 2014
skeletal muscle cell T-tubule Ab1-bin1 labeling decreased distribution, abnormal AB + MO2-bin1b Fig. 5 from Smith et al., 2014
skeletal muscle cell T-tubule morphology, abnormal AB + MO2-bin1b Fig. 4,  Fig. 7 from Smith et al., 2014
skeletal muscle cell T-tubule Ab2-cacna1c labeling spatial pattern, abnormal AB + MO2-bin1b Fig. 5 from Smith et al., 2014
skeletal muscle cell T-tubule Ab1-trdn labeling spatial pattern, abnormal AB + MO2-bin1b Fig. 5 from Smith et al., 2014
skeletal muscle cell Z disc Ab1-bin1 labeling decreased distribution, abnormal AB + MO2-bin1b Fig. 5 from Smith et al., 2014
trunk curved dorsal, abnormal AB + MO2-bin1b Fig. 3 from Smith et al., 2014
trunk kinked, abnormal AB + MO2-bin1b Fig. 3 from Smith et al., 2014
whole organism bin1b expression decreased amount, abnormal AB + MO2-bin1b Fig. 2 from Smith et al., 2014
Phenotype of all Fish created by or utilizing MO2-bin1b
Phenotype Fish Conditions Figures
skeletal muscle nucleus aggregated, abnormal AB + MO2-bin1b control Fig. 4 from Smith et al., 2014
trunk curved dorsal, abnormal AB + MO2-bin1b control Fig. 3 from Smith et al., 2014
skeletal muscle cell T-tubule Ab2-cacna1c labeling spatial pattern, abnormal AB + MO2-bin1b control Fig. 5 from Smith et al., 2014
skeletal muscle cell T-tubule Ab1-bin1 labeling decreased distribution, abnormal AB + MO2-bin1b control Fig. 5 from Smith et al., 2014
post-vent region kinked, abnormal AB + MO2-bin1b control Fig. 3 from Smith et al., 2014
skeletal muscle cell disorganized, abnormal AB + MO2-bin1b control Fig. 4,  Fig. 7 from Smith et al., 2014
skeletal muscle nucleolus low brightness, abnormal AB + MO2-bin1b control Fig. 4 from Smith et al., 2014
whole organism bin1b expression decreased amount, abnormal AB + MO2-bin1b control Fig. 2 from Smith et al., 2014
skeletal muscle cell Z disc Ab1-bin1 labeling decreased distribution, abnormal AB + MO2-bin1b control Fig. 5 from Smith et al., 2014
post-vent region curved dorsal, abnormal AB + MO2-bin1b control Fig. 3 from Smith et al., 2014
skeletal muscle nucleus circular, abnormal AB + MO2-bin1b control Fig. 4 from Smith et al., 2014
trunk kinked, abnormal AB + MO2-bin1b control Fig. 3 from Smith et al., 2014
skeletal muscle nucleus increased size, abnormal AB + MO2-bin1b control Fig. 4 from Smith et al., 2014
skeletal muscle cell T-tubule Ab1-trdn labeling spatial pattern, abnormal AB + MO2-bin1b control Fig. 5 from Smith et al., 2014
post-vent region bent, abnormal AB + MO2-bin1b control Fig. 3 from Smith et al., 2014
skeletal muscle nucleus mislocalised, abnormal AB + MO2-bin1b control Fig. 4 from Smith et al., 2014
skeletal muscle cell T-tubule morphology, abnormal AB + MO2-bin1b control Fig. 4,  Fig. 7 from Smith et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.