Morpholino

MO2-dnm1a

ID

ZDB-MRPHLNO-240711-4

Name

MO2-dnm1a

Previous Names

None

Target

dnm1a (1)

Sequence

5' - GTAGCCTAACGTCAGAAAACACATAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-dnm1a

No data available

Phenotype

Phenotype resulting from MO2-dnm1a

Phenotype	Fish	Figures
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 4 from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 4 from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 4 from Bragato et al., 2023
muscle cell atrophied, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
muscle cell decreased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
muscle cell disorganized, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
post-vent region curved, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 3 from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 5 from Bragato et al., 2023
somite C-shaped, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 3 from Bragato et al., 2023
thigmotaxis process quality, abnormal	AB + MO2-dnm1a + MO4-tp53	Table 2 from Bragato et al., 2023
whole organism dnm1a expression absent, abnormal	AB + MO2-dnm1a + MO4-tp53	Fig. 3 from Bragato et al., 2023

Phenotype of all Fish created by or utilizing MO2-dnm1a

Phenotype	Fish	Conditions	Figures
whole organism dnm1a expression absent, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 3 from Bragato et al., 2023
somite C-shaped, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 3 from Bragato et al., 2023
CaP motoneuron axon ab1-tuba labeling spatial pattern, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 4 from Bragato et al., 2023
post-vent region curved, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 3 from Bragato et al., 2023
CaP motoneuron neuron projection decreased branchiness, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 4 from Bragato et al., 2023
slow muscle cell spatial pattern, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
thigmotaxis process quality, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Table 2 from Bragato et al., 2023
myotome skeletal muscle myoblast increased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
muscle cell disorganized, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
muscle cell vacuole increased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
CaP motoneuron neuron projection decreased distribution, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 4 from Bragato et al., 2023
muscle cell atrophied, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
muscle cell decreased amount, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
muscle cell increased distance muscle cell, abnormal	AB + MO2-dnm1a + MO4-tp53	control	Fig. 5 from Bragato et al., 2023
thigmotaxis process quality, ameliorated	nsfa^tpl6Gt; tpl131Tg + MO2-dnm1a (AB)	control	Table 2 from Bragato et al., 2023

Citations