Morpholino
MO1-clvs2
- ID
- ZDB-MRPHLNO-230929-1
- Name
- MO1-clvs2
- Previous Names
- None
- Target
- Sequence
-
5' - GGCCTGCCTGTAAATGAGTCATTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-clvs2
No data available
Phenotype
Phenotype resulting from MO1-clvs2
Phenotype of all Fish created by or utilizing MO1-clvs2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
pericardium edematous, abnormal | WT + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
pronephric podocyte podocyte foot shortened, abnormal | WT + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
pronephric podocyte podocyte foot decreased thickness, abnormal | WT + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
pronephric glomerular basement membrane structure, abnormal | WT + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
eye edematous, abnormal | WT + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
renal filtration decreased process quality, abnormal | mi1000Tg + MO1-clvs2 | control |
Figure 2
from Lane et al., 2021 |
Citations