Morpholino
MO4-chl1a
- ID
- ZDB-MRPHLNO-220329-2
- Name
- MO4-chl1a
- Previous Names
-
- MS2 (1)
- Target
- Sequence
-
5' - ATCACCTGGAGGAATAACCGCATAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This MO targets isoforms 1 and 2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-chl1a
No data available
Phenotype
Phenotype resulting from MO4-chl1a
Phenotype of all Fish created by or utilizing MO4-chl1a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
trunk curled, abnormal | AB + MO3-chl1a + MO4-chl1a | control |
Fig. 7
from Yang et al., 2020 |
ventricular system accumulation cerebral spinal fluid, abnormal | AB + MO3-chl1a + MO4-chl1a | control |
Fig. 7
from Yang et al., 2020 |
ventricular system swollen, abnormal | AB + MO3-chl1a + MO4-chl1a | control |
Fig. 7
from Yang et al., 2020 |
ventricular system accumulation cerebral spinal fluid, abnormal | AB + MO4-chl1a | control |
Fig. 7
from Yang et al., 2020 |
ventricular system swollen, abnormal | AB + MO4-chl1a | control |
Fig. 7
from Yang et al., 2020 |
Reissner's fiber partially broken, abnormal | sqet33mi2AEt + MO4-chl1a (AB) | control |
Fig. 10
from Yang et al., 2020 |
Citations