Morpholino

MO1-smpx

ID

ZDB-MRPHLNO-220217-1

Name

MO1-smpx

Previous Names

ATG MO1 (1)

Target

smpx (1)

Sequence

5' - AAGGAAAGTGCTGTTCCCTGGTGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smpx

No data available

Phenotype

Phenotype resulting from MO1-smpx

Phenotype	Fish	Figures
anterior crista hair cell non-functional, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
fast muscle cell disorganized, abnormal	AB + MO1-smpx	Figure 2 from Ghilardi et al., 2021
inner ear mechanosensory behavior decreased process quality, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
lateral crista hair cell non-functional, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium decreased length, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium increased length, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium straight, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
lateral crista stereocilium shortened, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO1-smpx	Figure 3 from Diana et al., 2024
neuromast incomplete structure, abnormal	WT + MO1-smpx	Figure 3 from Diana et al., 2024
neuromast hair cell decreased functionality, abnormal	WT + MO1-smpx	Figure 5 from Diana et al., 2024
neuromast hair cell kinocilium decreased amount, abnormal	WT + MO1-smpx	Figure 6 from Diana et al., 2024
neuromast hair cell kinocilium decreased length, abnormal	WT + MO1-smpx	Figure 6 from Diana et al., 2024
post-vent region curved ventral, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
posterior crista hair cell non-functional, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021
posterior lateral line primordium decreased size, abnormal	WT + MO1-smpx	Figure 4 from Diana et al., 2024
posterior lateral line primordium morphology, abnormal	WT + MO1-smpx	Figure 4 from Diana et al., 2024
slow muscle cell disorganized, abnormal	AB + MO1-smpx	Figure 2 from Ghilardi et al., 2021
trunk curved ventral, abnormal	AB + MO1-smpx	Figure 1 from Ghilardi et al., 2021

Phenotype of all Fish created by or utilizing MO1-smpx

Phenotype	Fish	Conditions	Figures
slow muscle cell disorganized, abnormal	AB + MO1-smpx	control	Figure 2 from Ghilardi et al., 2021
fast muscle cell disorganized, abnormal	AB + MO1-smpx	control	Figure 2 from Ghilardi et al., 2021
post-vent region curved ventral, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
anterior crista hair cell non-functional, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
lateral crista hair cell non-functional, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
lateral crista stereocilium shortened, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
inner ear mechanosensory behavior decreased process quality, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium increased length, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium decreased length, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
trunk curved ventral, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
lateral crista kinocilium straight, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
posterior crista hair cell non-functional, abnormal	AB + MO1-smpx	control	Figure 1 from Ghilardi et al., 2021
posterior lateral line primordium morphology, abnormal	WT + MO1-smpx	standard conditions	Figure 4 from Diana et al., 2024
neuromast hair cell decreased functionality, abnormal	WT + MO1-smpx	standard conditions	Figure 5 from Diana et al., 2024
neuromast hair cell kinocilium decreased amount, abnormal	WT + MO1-smpx	standard conditions	Figure 6 from Diana et al., 2024
neuromast has fewer parts of type neuromast hair cell, abnormal	WT + MO1-smpx	standard conditions	Figure 3 from Diana et al., 2024
posterior lateral line primordium decreased size, abnormal	WT + MO1-smpx	standard conditions	Figure 4 from Diana et al., 2024
neuromast hair cell kinocilium decreased length, abnormal	WT + MO1-smpx	standard conditions	Figure 6 from Diana et al., 2024
neuromast incomplete structure, abnormal	WT + MO1-smpx	standard conditions	Figure 3 from Diana et al., 2024

Citations