Morpholino

MO1-zgc:112052

ID
ZDB-MRPHLNO-210907-3
Name
MO1-zgc:112052
Previous Names
None
Target
Sequence
5' - CGGCATAGTGCTTGGAAAGATTACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zgc:112052
No data available
Phenotype
Phenotype resulting from MO1-zgc:112052
Phenotype Fish Figures
brain decreased size, abnormal AB + MO1-zgc:112052 FIGURE 2 with image,  FIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 + MO4-tp53 FIGURE 2 with image,  FIGURE 3 with image from Mignani et al., 2020
dorsal root ganglion neuron EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 FIGURE 4 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 FIGURE 2 with image,  FIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 FIGURE 2 with image,  FIGURE 3 with image from Mignani et al., 2020
heart edematous, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
midbrain hindbrain boundary EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 FIGURE 5 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 FIGURE 4 with image,  FIGURE 5 with image from Mignani et al., 2020
post-vent region curved, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
post-vent region decreased thickness, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
skeletal muscle refractivity, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
skeletal muscle filamentous actin disorganized, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
somite development disrupted, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
thigmotaxis process quality, abnormal AB + MO1-zgc:112052 FIGURE 7 with image from Mignani et al., 2020
trunk decreased size, abnormal AB + MO1-zgc:112052 FIGURE 6 with image from Mignani et al., 2020
whole organism dead, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
whole organism decreased life span, abnormal AB + MO1-zgc:112052 FIGURE 2 with image from Mignani et al., 2020
Phenotype of all Fish created by or utilizing MO1-zgc:112052
Phenotype Fish Conditions Figures
heart edematous, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
trunk decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
somite development disrupted, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
post-vent region decreased thickness, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
whole organism dead, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
skeletal muscle filamentous actin disorganized, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
whole organism decreased life span, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
skeletal muscle refractivity, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 6 with image from Mignani et al., 2020
thigmotaxis process quality, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 7 with image from Mignani et al., 2020
post-vent region curved, abnormal AB + MO1-zgc:112052 standard conditions FIGURE 2 with image from Mignani et al., 2020
brain decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
brain morphology, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased diameter, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
eye decreased size, abnormal AB + MO1-zgc:112052 + MO4-tp53 standard conditions FIGURE 3 with image from Mignani et al., 2020
midbrain hindbrain boundary EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 standard conditions FIGURE 5 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal ia50Tg + MO1-zgc:112052 standard conditions FIGURE 5 with image from Mignani et al., 2020
dorsal root ganglion neuron EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 standard conditions FIGURE 4 with image from Mignani et al., 2020
optic tectum EGFP expression decreased amount, abnormal w61Tg + MO1-zgc:112052 standard conditions FIGURE 4 with image from Mignani et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.