Morpholino

MO1-tmem138

ID

ZDB-MRPHLNO-201218-1

Name

MO1-tmem138

Previous Names

None

Target

tmem138 (1)

Sequence

5' - GTAGTTATTTGTCTGGAGCATTTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tmem138

No data available

Phenotype

Phenotype resulting from MO1-tmem138

Phenotype	Fish	Figures
gastrulation process quality, abnormal	AB + MO1-tmem138	Fig. S18 from Lee et al., 2012
heart position, abnormal	twu34Tg + MO1-tmem138	Fig. S17 from Lee et al., 2012
notochord kinked, abnormal	AB + MO1-tmem138	Fig. S18 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem138	Fig. 4 from Lee et al., 2012
post-vent region curved, abnormal	AB + MO1-tmem138	Fig. 4 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem138	Fig. 4 from Lee et al., 2012
whole organism decreased length, abnormal	AB + MO1-tmem138	Fig. S18 from Lee et al., 2012
whole organism anterior region decreased size, abnormal	AB + MO1-tmem138	Fig. S18 from Lee et al., 2012

Phenotype of all Fish created by or utilizing MO1-tmem138

Phenotype	Fish	Conditions	Figures
post-vent region curved, abnormal	AB + MO1-tmem138	standard conditions	Fig. 4 from Lee et al., 2012
notochord kinked, abnormal	AB + MO1-tmem138	standard conditions	Fig. S18 from Lee et al., 2012
whole organism anterior region decreased size, abnormal	AB + MO1-tmem138	standard conditions	Fig. S18 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem138	standard conditions	Fig. 4 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem138	standard conditions	Fig. 4 from Lee et al., 2012
whole organism decreased length, abnormal	AB + MO1-tmem138	standard conditions	Fig. S18 from Lee et al., 2012
gastrulation process quality, abnormal	AB + MO1-tmem138	standard conditions	Fig. S18 from Lee et al., 2012
heart position, abnormal	twu34Tg + MO1-tmem138	standard conditions	Fig. S17 from Lee et al., 2012
post-vent region curved, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
post-vent region kinked, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
pericardium edematous, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
brain hydrocephalic, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
whole organism viability, abnormal	AB + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. 4 from Lee et al., 2012
heart position, abnormal	twu34Tg + MO1-tmem138 + MO1-tmem216	standard conditions	Fig. S17 from Lee et al., 2012

Citations