Morpholino

MO3-pax1b

ID

ZDB-MRPHLNO-201110-1

Name

MO3-pax1b

Previous Names

None

Target

pax1b (1)

Sequence

5' - GCATTGTGATATTTCCCTATACAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-pax1b

No data available

Phenotype

Phenotype resulting from MO3-pax1b

Phenotype	Fish	Figures
ceratobranchial 1 cartilage absent, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020
ceratobranchial 3 cartilage absent, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal	WT + MO3-pax1b	Fig. 4 from Liu et al., 2020

Phenotype of all Fish created by or utilizing MO3-pax1b

Phenotype	Fish	Conditions	Figures
ceratobranchial 3 cartilage absent, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 4 cartilage absent, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage absent, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 1 cartilage absent, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, abnormal	WT + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial cartilage absent, abnormal	pax1a^as36/+ + MO3-pax1b	standard conditions	Fig. 5 from Liu et al., 2020
pharyngeal arch 4 dlx2a expression decreased amount, abnormal	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 7 from Liu et al., 2020
ceratohyal cartilage inverted, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
pharyngeal arch 5 dlx2a expression decreased amount, abnormal	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 7 from Liu et al., 2020
pharyngeal arch 3 dlx2a expression decreased amount, abnormal	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 7 from Liu et al., 2020
ceratobranchial 1 cartilage absent, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 4 cartilage absent, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage absent, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 3 cartilage decreased length, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratohyal cartilage straight, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 2 cartilage decreased length, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020
ceratobranchial 3 cartilage absent, exacerbated	WT + MO1-pax1a + MO3-pax1b	standard conditions	Fig. 4 from Liu et al., 2020

Citations