Morpholino

MO1-slc30a1a

ID
ZDB-MRPHLNO-200916-5
Name
MO1-slc30a1a
Previous Names
None
Target
Sequence
5' - GCGGAGCACAGACAGAAACAAAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc30a1a
No data available
Phenotype
Phenotype resulting from MO1-slc30a1a
Phenotype Fish Figures
blastoderm zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 5 from Muraina et al., 2020
central nervous system slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
chordate embryonic development delayed, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
chorion zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 5 from Muraina et al., 2020
chorion zinc(2+) present, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 5 from Muraina et al., 2020
hatching gland slc30a1a expression absent, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
margin ab9-mapk labeling decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 6 from Muraina et al., 2020
margin zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 5 from Muraina et al., 2020
muscle decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
whole organism decreased pigmentation, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
whole organism zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 4 from Muraina et al., 2020
yolk increased size, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
yolk syncytial layer slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 3 from Muraina et al., 2020
zinc ion sequestering activity increased efficacy, abnormal WT + MO1-slc30a1a + MO4-tp53 Fig. 4 from Muraina et al., 2020
Phenotype of all Fish created by or utilizing MO1-slc30a1a
Phenotype Fish Conditions Figures
chorion zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
whole organism zinc(2+) increased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 4 from Muraina et al., 2020
margin ab9-mapk labeling decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 6 from Muraina et al., 2020
chordate embryonic development delayed, exacerbated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: zinc sulfate Fig. 3 from Muraina et al., 2020
hatching gland zinc(2+) increased amount, ameliorated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: zinc sulfate Fig. 5 from Muraina et al., 2020
zinc ion sequestering activity increased efficacy, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 4 from Muraina et al., 2020
chordate embryonic development delayed, ameliorated WT + MO1-slc30a1a + MO4-tp53 chemical treatment by environment: N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine Fig. 3 from Muraina et al., 2020
muscle decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
yolk syncytial layer slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
blastoderm zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
whole organism decreased pigmentation, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
central nervous system slc30a1a expression spatial pattern, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
chordate embryonic development delayed, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
yolk increased size, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
chorion zinc(2+) present, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
margin zinc(2+) decreased amount, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 5 from Muraina et al., 2020
hatching gland slc30a1a expression absent, abnormal WT + MO1-slc30a1a + MO4-tp53 standard conditions Fig. 3 from Muraina et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.